Open Science Research Excellence

Open Science Index

Commenced in January 2007 Frequency: Monthly Edition: International Paper Count: 57

57
10010872
Demographic and Socio-Economic Study of the Elderly Population in Kolkata, India
Abstract:

Kolkata, the City of Joy, is a greying metropolis not only in respect of its concrete jungle but also because of the largest population of 60-plus residents that it shelters among all other cities in India. Declining birth and death rates and a negative growth of population indicate that the city has reached the last stage of demographic transition. Thus, the obvious consequence has been the ageing of its population. With this background, the present paper attempts to study the demographic and socio-economic status of the elderly population in Kolkata. Analysis and findings have been based on secondary data obtained from Census of India of various years, Sample Registration System Reports and reports by HelpAge India. Findings show that the elderly population is increasing continuously. With respect to gender, the male elderly outnumbers the female elderly population. The percentage of households having one elderly member is more in the city due to the emergence of the nuclear families and erosion of joint family system. With respect to socio-economic status, those elderly who are the heads of the family are lower in percentages than those in the other age groups. Also, male elderly as head of the family are greater in percentage than female elderly. Elderly in the category of currently married records the highest percentage followed by widowed, never married and lastly, separated or divorced. Male elderly outnumber the female elderly as currently married, while female elderly outnumbers the male elderly in the category of widowed. In terms of living status, the percentage of elderly who are living alone is highest in Kolkata and the reason for staying alone as no support from children also happens to be highest in this city. The literacy rate and higher level of education is higher among the male than female elderly. Higher percentages of female elderly have been found to be with disability. Disability in movement and multiple disabilities have been found to be more common among the elderly population in Kolkata. Percentages of male literate pensioners are highest than other categories. Also, in terms of levels of education male elderly who are graduate and above other than technical degree are the highest receivers of pension. Also, in terms of working status, elderly as non-workers are higher in percentages with the population of elderly females outnumbering the males. The old age dependency ratio in the city is increasing continuously and the ratio is higher among females than male. Thus, it can be stated that Kolkata is witnessing continuous and rapid ageing of its population. Increasing dependency ratio is likely to create pressure on the working population, available civic, social and health amenities. This requires intervention in the form of planning, formulation and implementation of laws, policies, programs and measures to safeguard and improve the conditions of the elderly in Kolkata.

56
10010707
Exploring the Correlation between Population Distribution and Urban Heat Island under Urban Data: Taking Shenzhen Urban Heat Island as an Example
Authors:
Abstract:

Shenzhen is a modern city of China's reform and opening-up policy, the development of urban morphology has been established on the administration of the Chinese government. This city`s planning paradigm is primarily affected by the spatial structure and human behavior. The subjective urban agglomeration center is divided into several groups and centers. In comparisons of this effect, the city development law has better to be neglected. With the continuous development of the internet, extensive data technology has been introduced in China. Data mining and data analysis has become important tools in municipal research. Data mining has been utilized to improve data cleaning such as receiving business data, traffic data and population data. Prior to data mining, government data were collected by traditional means, then were analyzed using city-relationship research, delaying the timeliness of urban development, especially for the contemporary city. Data update speed is very fast and based on the Internet. The city's point of interest (POI) in the excavation serves as data source affecting the city design, while satellite remote sensing is used as a reference object, city analysis is conducted in both directions, the administrative paradigm of government is broken and urban research is restored. Therefore, the use of data mining in urban analysis is very important. The satellite remote sensing data of the Shenzhen city in July 2018 were measured by the satellite Modis sensor and can be utilized to perform land surface temperature inversion, and analyze city heat island distribution of Shenzhen. This article acquired and classified the data from Shenzhen by using Data crawler technology. Data of Shenzhen heat island and interest points were simulated and analyzed in the GIS platform to discover the main features of functional equivalent distribution influence. Shenzhen is located in the east-west area of China. The city’s main streets are also determined according to the direction of city development. Therefore, it is determined that the functional area of the city is also distributed in the east-west direction. The urban heat island can express the heat map according to the functional urban area. Regional POI has correspondence. The research result clearly explains that the distribution of the urban heat island and the distribution of urban POIs are one-to-one correspondence. Urban heat island is primarily influenced by the properties of the underlying surface, avoiding the impact of urban climate. Using urban POIs as analysis object, the distribution of municipal POIs and population aggregation are closely connected, so that the distribution of the population corresponded with the distribution of the urban heat island.

55
10010558
Main Cause of Children's Deaths in Indigenous Wayuu Community from Department of La Guajira: A Research Developed through Data Mining Use
Abstract:

The main purpose of this research is to discover what causes death in children of the Wayuu community, and deeply analyze those results in order to take corrective measures to properly control infant mortality. We consider important to determine the reasons that are producing early death in this specific type of population, since they are the most vulnerable to high risk environmental conditions. In this way, the government, through competent authorities, may develop prevention policies and the right measures to avoid an increase of this tragic fact. The methodology used to develop this investigation is data mining, which consists in gaining and examining large amounts of data to produce new and valuable information. Through this technique it has been possible to determine that the child population is dying mostly from malnutrition. In short, this technique has been very useful to develop this study; it has allowed us to transform large amounts of information into a conclusive and important statement, which has made it easier to take appropriate steps to resolve a particular situation.

54
10010636
A Remote Sensing Approach to Calculate Population Using Roads Network Data in Lebanon
Abstract:

In developing countries, such as Lebanon, the demographic data are hardly available due to the absence of the mechanization of population system. The aim of this study is to evaluate, using only remote sensing data, the correlations between the number of population and the characteristics of roads network (length of primary roads, length of secondary roads, total length of roads, density and percentage of roads and the number of intersections). In order to find the influence of the different factors on the demographic data, we studied the degree of correlation between each factor and the number of population. The results of this study have shown a strong correlation between the number of population and the density of roads and the number of intersections.

53
10009523
Optimisation of Structural Design by Integrating Genetic Algorithms in the Building Information Modelling Environment
Abstract:

Structural design and analysis is an important and time-consuming process, particularly at the conceptual design stage. Decisions made at this stage can have an enormous effect on the entire project, as it becomes ever costlier and more difficult to alter the choices made early on in the construction process. Hence, optimisation of the early stages of structural design can provide important efficiencies in terms of cost and time. This paper suggests a structural design optimisation (SDO) framework in which Genetic Algorithms (GAs) may be used to semi-automate the production and optimisation of early structural design alternatives. This framework has the potential to leverage conceptual structural design innovation in Architecture, Engineering and Construction (AEC) projects. Moreover, this framework improves the collaboration between the architectural stage and the structural stage. It will be shown that this SDO framework can make this achievable by generating the structural model based on the extracted data from the architectural model. At the moment, the proposed SDO framework is in the process of validation, involving the distribution of an online questionnaire among structural engineers in the UK.

52
10009354
Reduction in Population Growth under Various Contraceptive Strategies in Uttar Pradesh, India
Abstract:

Contraceptive policies have been derived to achieve desired reductions in the growth rate and also, applied to the data of Uttar-Pradesh, India for illustration. Using the Lotka’s integral equation for the stable population, expressions for the proportion of contraceptive users at different ages have been obtained. At the age of 20 years, 42% of contraceptive users is imperative to reduce the present annual growth rate of 0.036 to 0.02, assuming that 40% of the contraceptive users discontinue at the age of 25 years and 30% again continue contraceptive use at age 30 years. Further, presuming that 75% of women start using contraceptives at the age of 23 years, and 50% of the remaining women start using contraceptives at the age of 28 years, while the rest of them start using it at the age of 32 years. If we set a minimum age of marriage as 20 years, a reduction of 0.019 in growth rate will be obtained. This study describes how the level of contraceptive use at different age groups of women reduces the growth rate in the state of Uttar Pradesh. The article also promotes delayed marriage in the region.

51
10009291
Accessible Facilities in Home Environment for Elderly Family Members in Sri Lanka
Abstract:

The world is facing several problems due to increasing elderly population. In Sri Lanka, along with the complexity of the modern society and structural and functional changes of the family, “caring for elders” seems as an emerging social problem. This situation may intensify as the county is moving into a middle income society. Seeking higher education and related career opportunities, and urban living in modern housing are new trends, through which several problems are generated. Among many issues related with elders, “lack of accessible and appropriate facilities in their houses as well as public buildings” can be identified as a major problem. This study argues that welfare facilities provided for the elderly people, particularly in the home environment, in the country are not adequate. Modern housing features such as bathrooms, pantries, lobbies, and leisure areas etc. are questionable as to whether they match with elders’ physical and mental needs. Consequently, elders have to face domestic accidents and many other difficulties within their living environments. Records of hospitals in the country also proved this fact. Therefore, this study tries to identify how far modern houses are suited with elders’ needs. The study further questioned whether “aging” is a considerable matter when people are buying, planning and renovating houses. A randomly selected sample of 50 houses were observed and 50 persons were interviewed around the Maharagama urban area in Colombo district to obtain primary data, while relevant secondary data and information were used to have a depth analysis. The study clearly found that none of the houses included to the sample are considering elders’ needs in planning, renovating, or arranging the home. Instead, most of the families were giving priority to the rich and elegant appearance and modern facilities of the houses. Particularly, to the bathrooms, pantry, large setting areas, balcony, parking slots for two vehicles, ad parapet walls with roller-gates are the main concerns. A significant factor found here is that even though, many children of the aged are in middle age and reaching their older years at present, they do not plan their future living within a safe and comfortable home, despite that they are hoping to spent the latter part of their lives in the their current homes. This fact highlights that not only the other responsible parts of the society, but also those who are reaching their older ages are ignoring the problems of the aged. At the same time, it was found that more than 80% of old parents do not like to stay at their children’s homes as the living environments in such modern homes are not familiar or convenient for them. Due to this context, the aged in Sri Lanka may have to be alone in their own homes due to current trend of society of migrating to urban living in modern houses. At the same time, current urban families who live in modern houses may have to face adding accessible facilities in their home environment, as current modern housing facilities may not be appropriate them for a better life in their latter part of life.

50
10008756
Urban and Rural Children’s Knowledge on Biodiversity in Bizkaia: Tree Identification Skills and Animal and Plant Listing
Abstract:
Biodiversity provides humans with a great range of ecosystemic services; it is therefore an indispensable resource and a legacy to coming generations. However, in the last decades, the increasing exploitation of the Planet has caused a great loss of biodiversity and its acquaintance has decreased remarkably; especially in urbanized areas, due to the decreasing attachment of humans to nature. Yet, the Primary Education curriculum primes the identification of flora and fauna to guarantee the knowledge of children on their surroundings, so that they care for the environment as well as for themselves. In order to produce effective didactic material that meets the needs of both teachers and pupils, it is fundamental to diagnose the current situation. In the present work, the knowledge on biodiversity of 3rd cycle Primary Education students in Biscay (n=98) and its relation to the size of the town/city of their school is discussed. Two tests have been used with such aim: one for tree identification and the other one so that the students enumerated the species of trees and animals they knew. Results reveal that knowledge of students on tree identification is scarce regardless the size of the city/town and of their school. On the other hand, animal species are better known than tree species.
49
10008083
Prediction of Product Size Distribution of a Vertical Stirred Mill Based on Breakage Kinetics
Abstract:

In the last decade there has been an increase in demand for fine grinding due to the depletion of coarse-grained orebodies and an increase of processing fine disseminated minerals and complex orebodies. These ores have provided new challenges in concentrator design because fine and ultra-fine grinding is required to achieve acceptable recovery rates. Therefore, the correct design of a grinding circuit is important for minimizing unit costs and increasing product quality. The use of ball mills for grinding in fine size ranges is inefficient and, therefore, vertical stirred grinding mills are becoming increasingly popular in the mineral processing industry due to its already known high energy efficiency. This work presents a hypothesis of a methodology to predict the product size distribution of a vertical stirred mill using a Bond ball mill. The Population Balance Model (PBM) was used to empirically analyze the performance of a vertical mill and a Bond ball mill. The breakage parameters obtained for both grinding mills are compared to determine the possibility of predicting the product size distribution of a vertical mill based on the results obtained from the Bond ball mill. The biggest advantage of this methodology is that most of the minerals processing laboratories already have a Bond ball mill to perform the tests suggested in this study. Preliminary results show the possibility of predicting the performance of a laboratory vertical stirred mill using a Bond ball mill.

48
10008193
Development and Psychometric Properties of the Relational Mobility Scale for the Indonesian Population
Abstract:

This study aims to develop the Relational Mobility Scale for the Indonesian population and to investigate its psychometric properties. New items of the scale were created taking into account the Indonesian population which consists of two parallel forms (A and A’). This study uses 30 newly orchestrated items while keeping in mind the characteristics of the targeted population. The scale was administered to 433 public high school students in Malang, Indonesia. Construct validity of its factor structure was demonstrated using exploratory factor analysis and confirmatory factor analysis. The result exhibits that he model fits the data, and that the delayed alternate form method shows acceptable result. Results yielded that 21 items of the three-dimensional Relational Mobility Scale is suitable for measuring relational mobility in high school students of Indonesian population.

47
10007556
Power of Doubling: Population Growth and Resource Consumption
Abstract:

Sustainability starts with conserving resources for future generations. Since human’s existence on this earth, he has been consuming natural resources. The resource consumption pace in the past was very slow, but industrialization in 18th century brought a change in the human lifestyle. New inventions and discoveries upgraded the human workforce to machines. The mass manufacture of goods provided easy access to products. In the last few decades, the globalization and change in technologies brought consumer oriented market. The consumption of resources has increased at a very high scale. This overconsumption pattern brought economic boom and provided multiple opportunities, but it also put stress on the natural resources. This paper tries to put forth the facts and figures of the population growth and consumption of resources with examples. This is explained with the help of the mathematical expression of doubling known as exponential growth. It compares the carrying capacity of the earth and resource consumption of humans’ i.e. ecological footprint and bio-capacity. Further, it presents the need to conserve natural resources and re-examine sustainable resource use approach for sustainability.

46
10006732
Non-Population Search Algorithms for Capacitated Material Requirement Planning in Multi-Stage Assembly Flow Shop with Alternative Machines
Abstract:

This paper aims to present non-population search algorithms called tabu search (TS), simulated annealing (SA) and variable neighborhood search (VNS) to minimize the total cost of capacitated MRP problem in multi-stage assembly flow shop with two alternative machines. There are three main steps for the algorithm. Firstly, an initial sequence of orders is constructed by a simple due date-based dispatching rule. Secondly, the sequence of orders is repeatedly improved to reduce the total cost by applying TS, SA and VNS separately. Finally, the total cost is further reduced by optimizing the start time of each operation using the linear programming (LP) model. Parameters of the algorithm are tuned by using real data from automotive companies. The result shows that VNS significantly outperforms TS, SA and the existing algorithm.

45
10006741
A Mathematical Investigation of the Turkevich Organizer Theory in the Citrate Method for the Synthesis of Gold Nanoparticles
Abstract:

Gold nanoparticles are commonly synthesized by reducing chloroauric acid with sodium citrate. This method, referred to as the citrate method, can produce spherical gold nanoparticles (NPs) in the size range 10-150 nm. Gold NPs of this size are useful in many applications. However, the NPs are usually polydisperse and irreproducible. A better understanding of the synthesis mechanisms is thus required. This work thoroughly investigated the only model that describes the synthesis. This model combines mass and population balance equations, describing the NPs synthesis through a sequence of chemical reactions. Chloroauric acid reacts with sodium citrate to form aurous chloride and dicarboxy acetone. The latter organizes aurous chloride in a nucleation step and concurrently degrades into acetone. The unconsumed precursor then grows the formed nuclei. However, depending on the pH, both the precursor and the reducing agent react differently thus affecting the synthesis. In this work, we investigated the model for different conditions of pH, temperature and initial reactant concentrations. To solve the model, we used Parsival, a commercial numerical code, whilst to test it, we considered various conditions studied experimentally by different researchers, for which results are available in the literature. The model poorly predicted the experimental data. We believe that this is because the model does not account for the acid-base properties of both chloroauric acid and sodium citrate.

44
10006744
A Study on Vulnerability of Alahsa Governorate to Generate Urban Heat Islands
Abstract:

The purpose of this study is to investigate Alahsa Governorate status and its vulnerability to generate urban heat islands. Alahsa Governorate is a famous oasis in the Arabic Peninsula including several oil centers. Extensive literature review was done to collect previous relative data on the urban heat island of Alahsa Governorate. Data used for the purpose of this research were collected from authorized bodies who control weather station networks over Alahsa Governorate, Eastern Province, Saudi Arabia. Although, the number of weather station networks within the region is very limited and the analysis using GIS software and its techniques is difficult and limited, the data analyzed confirm an increase in temperature for more than 2 °C from 2004 to 2014. Such increase is considerable whenever human health and comfort are the concern. The increase of temperature within one decade confirms the availability of urban heat islands. The study concludes that, Alahsa Governorate is vulnerable to create urban heat islands and more attention should be drawn to strategic planning of the governorate that is developing with a high pace and considerable increasing levels of urbanization.

43
10005669
Regulation of Water Balance of the Plant from the Different Geo-Environmental Locations
Abstract:
Under the drought stress condition, the plants would grow slower. Temperature is one of the most important abiotic factors which suppress the germination processes. However, the processes of transpiration are regulated directly by the cell water, which followed to an increase in volume of vacuoles. During stretching under the influence of water pressure, the cell goes into the state of turgor. In our experiments, lines of the semi-dental sweet maize of Armenian population from various zones of growth under mild and severe drought stress were tested. According to results, the value of the water balance of the plant cells may reflect the ability of plants to adapt to drought stress. It can be assumed that the turgor allows evaluating the number of received dissolved substance in cell.
42
10005129
Land Use Land Cover Changes in Response to Urban Sprawl within North-West Anatolia, Turkey
Abstract:
In the present study, an attempt was made to state the Land Use Land Cover (LULC) transformation over three decades around the urban regions of Balıkesir, Bursa, and Çanakkale provincial centers (PCs) in Turkey. Landsat imageries acquired in 1984, 1999 and 2014 were used to determine the LULC change. Images were classified using the supervised classification technique and five main LULC classes were considered including forest (F), agricultural land (A), residential area (urban) - bare soil (R-B), water surface (W), and other (O). Change detection analyses were conducted for 1984-1999 and 1999-2014, and the results were evaluated. Conversions of LULC types to R-B class were investigated. In addition, population changes (1985-2014) were assessed depending on census data, the relations between population and the urban areas were stated, and future populations and urban area needs were forecasted for 2030. The results of LULC analysis indicated that urban areas, which are covered under R-B class, were expanded in all PCs. During 1984-1999 R-B class within Balıkesir, Bursa and Çanakkale PCs were found to have increased by 7.1%, 8.4%, and 2.9%, respectively. The trend continued in the 1999-2014 term and the increment percentages reached to 15.7%, 15.5%, and 10.2% at the end of 30-year period (1984-2014). Furthermore, since A class in all provinces was found to be the principal contributor for the R-B class, urban sprawl lead to the loss of agricultural lands. Moreover, the areas of R-B classes were highly correlated with population within all PCs (R2>0.992). Depending on this situation, both future populations and R-B class areas were forecasted. The estimated values of increase in the R-B class areas for Balıkesir, Bursa, and Çanakkale PCs were 1,586 ha, 7,999 ha and 854 ha, respectively. Due to this fact, the forecasted values for 2,030 are 7,838 ha, 27,866, and 2,486 ha for Balıkesir, Bursa, and Çanakkale, and thus, 7.7%, 8.2%, and 9.7% more R-B class areas are expected to locate in PCs in respect to the same order.
41
10004480
Genetic Diversity Based Population Study of Freshwater Mud Eel (Monopterus cuchia) in Bangladesh
Abstract:

As genetic diversity is most important for existing, breeding and production of any fish; this study was undertaken for investigating genetic diversity of freshwater mud eel, Monopterus cuchia at population level where three ecological populations such as flooded area of Sylhet (P1), open water of Moulvibazar (P2) and open water of Sunamganj (P3) districts of Bangladesh were considered. Four arbitrary RAPD primers (OPB-12, C0-4, B-03 and OPB-08) were screened and RAPD banding patterns were analyzed among the populations considering 15 individuals of each population. In total 174, 138 and 149 bands were detected in the populations of P1, P2 and P3 respectively; however, each primer revealed less number of bands in each population. 100% polymorphic loci were recorded in P2 and P3 whereas only one monomorphic locus was observed in P1, recorded 97.5% polymorphism. Different genetic parameters such as inter-individual pairwise similarity, genetic distance, Nei genetic similarity, linkage distances, cluster analysis and allelic information, etc. were considered for measuring genetic diversity. The average inter-individual pairwise similarity was recorded 2.98, 1.47 and 1.35 in P1, P2 and P3 respectively. Considering genetic distance analysis, the highest distance 1 was recorded in P2 and P3 and the lowest genetic distance 0.444 was found in P2. The average Nei genetic similarity was observed 0.19, 0.16 and 0.13 in P1, P2 and P3, respectively; however, the average linkage distance was recorded 24.92, 17.14 and 15.28 in P1, P3 and P2 respectively. Based on linkage distance, genetic clusters were generated in three populations where 6 clades and 7 clusters were found in P1, 3 clades and 5 clusters were observed in P2 and 4 clades and 7 clusters were detected in P3. In addition, allelic information was observed where the frequency of p and q alleles were observed 0.093 and 0.907 in P1, 0.076 and 0.924 in P2, 0.074 and 0.926 in P3 respectively. The average gene diversity was observed highest in P2 (0.132) followed by P3 (0.131) and P1 (0.121) respectively.

40
10006857
Experimental Correlation for Erythrocyte Aggregation Rate in Population Balance Modeling
Abstract:

Red Blood Cells (RBCs) or erythrocytes tend to form chain-like aggregates under low shear rate called rouleaux. This is a reversible process and rouleaux disaggregate in high shear rates. Therefore, RBCs aggregation occurs in the microcirculation where low shear rates are present but does not occur under normal physiological conditions in large arteries. Numerical modeling of RBCs interactions is fundamental in analytical models of a blood flow in microcirculation. Population Balance Modeling (PBM) is particularly useful for studying problems where particles agglomerate and break in a two phase flow systems to find flow characteristics. In this method, the elementary particles lose their individual identity due to continuous destructions and recreations by break-up and agglomeration. The aim of this study is to find RBCs aggregation in a dynamic situation. Simplified PBM was used previously to find the aggregation rate on a static observation of the RBCs aggregation in a drop of blood under the microscope. To find aggregation rate in a dynamic situation we propose an experimental set up testing RBCs sedimentation. In this test, RBCs interact and aggregate to form rouleaux. In this configuration, disaggregation can be neglected due to low shear stress. A high-speed camera is used to acquire video-microscopic pictures of the process. The sizes of the aggregates and velocity of sedimentation are extracted using an image processing techniques. Based on the data collection from 5 healthy human blood samples, the aggregation rate was estimated as 2.7x103(±0.3 x103) 1/s.

39
10003380
SMART: Solution Methods with Ants Running by Types
Abstract:
Ant algorithms are well-known metaheuristics which have been widely used since two decades. In most of the literature, an ant is a constructive heuristic able to build a solution from scratch. However, other types of ant algorithms have recently emerged: the discussion is thus not limited by the common framework of the constructive ant algorithms. Generally, at each generation of an ant algorithm, each ant builds a solution step by step by adding an element to it. Each choice is based on the greedy force (also called the visibility, the short term profit or the heuristic information) and the trail system (central memory which collects historical information of the search process). Usually, all the ants of the population have the same characteristics and behaviors. In contrast in this paper, a new type of ant metaheuristic is proposed, namely SMART (for Solution Methods with Ants Running by Types). It relies on the use of different population of ants, where each population has its own personality.
38
10001816
Urban and Rural Population Pyramids in Georgia Since 1950s
Abstract:
In the years followed independence, an economic crisis and some conflicts led to the displacement of many people inside Georgia. The growing poverty, unemployment, low income and its unequal distribution limited access to basic social service have had a clear direct impact on Georgian population dynamics and its age-sex structure. Factors influencing the changing population age structure and urbanization include mortality, fertility, migration and expansion of urban. In this paper presents the main factors of changing the distribution by urban and rural areas. How different are the urban and rural age and sex structures? Does Georgia have the same age-sex structure among their urban and rural populations since 1950s?
37
10002264
Calculation of a Sustainable Quota Harvesting of Long-Tailed Macaque (Macaca fascicularis Raffles) in Their Natural Habitats
Abstract:
The global demand for long-tailed macaques for medical experimentation has continued to increase. Fulfillment of Indonesian export demands has been mostly from natural habitats, based on a harvesting quota. This quota has been determined according to the total catch for a given year, and not based on consideration of any demographic parameters or physical environmental factors with regard to the animal; hence threatening the sustainability of the various populations. It is therefore necessary to formulate a method for calculating a sustainable harvesting quota, based on population parameters in natural habitats. Considering the possibility of variations in habitat characteristics and population parameters, a time series observation of demographic and physical/biotic parameters, in various habitats, was performed on 13 groups of long-tailed macaques, distributed throughout the West Java, Lampung and Yogyakarta areas of Indonesia. These provinces were selected for comparison of the influence of human/tourism activities. Data on population parameters that was collected included data on life expectancy according to age class, numbers of individuals by sex and age class, and ‘ratio of infants to reproductive females’. The estimation of population growth was based on a population dynamic growth model: the Leslie matrix. The harvesting quota was calculated as being the difference between the actual population size and the MVP (minimum viable population) for each sex and age class. Observation indicated that there were variations within group size (24–106 individuals), gender (sex) ratio (1:1 to 1:1.3), life expectancy value (0.30 to 0.93), and ‘ratio of infants to reproductive females’ (0.23 to 1.56). Results of subsequent calculations showed that sustainable harvesting quotas for each studied group of long-tailed macaques, ranged from 29 to 110 individuals. An estimation model of the MVP for each age class was formulated as Log Y = 0.315 + 0.884 Log Ni (number of individual on ith age class). This study also found that life expectancy for the juvenile age class was affected by the humidity under tree stands, and dietary plants’ density at sapling, pole and tree stages (equation: Y=2.296 – 1.535 RH + 0.002 Kpcg – 0.002 Ktg – 0.001 Kphn, R2 = 89.6% with a significance value of 0.001). By contrast, for the sub-adult-adult age class, life expectancy was significantly affected by slope (equation: Y=0.377 = 0.012 Kml, R2 = 50.4%, with significance level of 0.007). The infant-toreproductive- female ratio was affected by humidity under tree stands, and dietary plant density at sapling and pole stages (equation: Y = - 1.432 + 2.172 RH – 0.004 Kpcg + 0.003 Ktg, R2 = 82.0% with significance level of 0.001). This research confirmed the importance of population parameters in determining the minimum viable population, and that MVP varied according to habitat characteristics (especially food availability). It would be difficult therefore, to formulate a general mathematical equation model for determining a harvesting quota for the species as a whole.
36
10000555
In silico Repopulation Model of Various Tumour Cells during Treatment Breaks in Head and Neck Cancer Radiotherapy
Abstract:

Advanced head and neck cancers are aggressive tumours, which require aggressive treatment. Treatment efficiency is often hindered by cancer cell repopulation during radiotherapy, which is due to various mechanisms triggered by the loss of tumour cells and involves both stem and differentiated cells. The aim of the current paper is to present in silico simulations of radiotherapy schedules on a virtual head and neck tumour grown with biologically realistic kinetic parameters. Using the linear quadratic formalism of cell survival after radiotherapy, altered fractionation schedules employing various treatment breaks for normal tissue recovery are simulated and repopulation mechanism implemented in order to evaluate the impact of various cancer cell contribution on tumour behaviour during irradiation. The model has shown that the timing of treatment breaks is an important factor influencing tumour control in rapidly proliferating tissues such as squamous cell carcinomas of the head and neck. Furthermore, not only stem cells but also differentiated cells, via the mechanism of abortive division, can contribute to malignant cell repopulation during treatment.

35
10000600
Population Structure of European Pond Turtles, Emys orbicularis (Linnaeus, 1758) in Narta Lagoon (Vlora Bay, Albania)
Abstract:

In this study was monitored the population of the European Pond Turtle, Emys orbicularis (Linnaeus, 1758) in the area of Narta Lagoon, Vlora Bay (Albania), from August to October 2014. A total of 54 individuals of E. orbicularis were studied using different methodologies. Curved Carapace Length (CCL), Plastron Length (PL) and Curved Carapace Width (CCW) were measured for each individual of E. orbicularis and were statistically analyzed. All captured turtles were separated in seven different size – classes based on their carapace length (CCL). Each individual of E. orbicularis was marked by notching the carapace (marginal scutes). Form all individuals captured resulted that 37 were females (68.5%), 14 males (25.9%), 3 juveniles (5.5%), while 18 individuals of E. orbicularis were recaptured for the first and some for the second time.

34
10004026
Effective Communication with the Czech Customers 50+ in the Financial Market
Abstract:
The paper deals with finding and describing of the effective marketing communication forms relating to the segment 50+ in the financial market in the Czech Republic. The segment 50+ can be seen as a great marketing potential in the future but unfortunately the Czech financial institutions haven´t still reacted enough to this fact and they haven´t prepared appropriate marketing programs for this customers´ segment. Demographic aging is a fundamental characteristic of the current European population evolution but the perspective of further population aging is more noticeable in the Czech Republic. This paper is based on data from one part of primary marketing research. Paper determinates the basic problem areas as well as definition of marketing communication in the financial market, defining the primary research problem, hypothesis and primary research methodology. Finally suitable marketing communication approach to selected sub-segment at age of 50-60 years is proposed according to marketing research findings.
33
9998938
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa
Abstract:

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

32
9998218
Viral Advertising: Popularity and Willingness to Share among the Czech Internet Population
Authors:
Abstract:

This paper presents results of primary quantitative research on viral advertising with focus on popularity and willingness to share viral video among Czech Internet population. It starts with brief theoretical debate on viral advertising, which is used for the comparison of the results. For purpose of collecting data, online questionnaire survey was given to 384 respondents. Statistics utilized in this research included frequency, percentage, correlation and Pearson’s Chi-square test. Data was evaluated using SPSS software. The research analysis disclosed high popularity of viral advertising video among Czech Internet population but implies lower willingness to share it. Significant relationship between likability of viral video technique and age of the viewer was found.

31
9998457
The Impact of Rapid Urbanisation on Public Transport Systems in the Gauteng Region of South Africa
Abstract:

This paper seeks to illustrate the impact of rapid urbanization (in terms of both increase in people and vehicles) in the Gauteng region (which includes Johannesburg, Pretoria and Ekurhuleni). The impact that existing transport systems and options place on the capacity of residents from low income areas to travel and conduct various socio-economic activities is discussed. The findings are drawn from a 2013 analysis of a random transport household survey of 1550 households carried out in Gauteng province. 91.4% of the study respondents had access to public transport, while 8.6% had no access to public transport. Of the 91.4% who used public transport, the main reason used to explain this state of affairs was that it was affordable (54.3%), convenient (15.9%), Accessible (11.9%), lack of alternatives (6.4%) and reliable at 4.1%. Recommendations advanced revolve around the need to reverse land use and transportation effects of apartheid planning, growing and developing a sustainable critical mass of public transport interventions supported by appropriate transport systems that are environmentally sustainable through proper governance. 38.5% of the respondents indicated that developing compact, smart and integrated urban land spaces was key to reducing travel challenges in the study area. 23.4% indicated that the introduction and upgrading of BRT buses to cover all areas in the study area was a step in the right direction because it has great potential in shifting travel patterns to favor public modes of transport. 15.1% indicated that all open spaces should be developed so that fragmentation of land uses can be addressed. This would help to fight disconnected and fragmented space and trip making challenges in Gauteng. 13.4% indicated that improving the metro rail services was critical since this is a mass mover of commuters. 9.6% of the respondents highlighted that the bus subsidy policy has to be retained in the short to medium term since the spatial mismatches and challenges created by apartheid are yet to be fully reversed.

30
9999151
Targeting the Life Cycle Stages of the Diamond Back Moth (Plutella xylostella) with Three Different Parasitoid Wasps
Abstract:

A continuous time model of the interaction between crop insect pests and naturally beneficial pest enemies is created using a set of simultaneous, non-linear, ordinary differential equations incorporating natural death rates based on the Weibull distribution. The crop pest is present in all its life-cycle stages of: egg, larva, pupa and adult. The beneficial insects, parasitoid wasps, may be present in either or all parasitized: eggs, larva and pupa. Population modelling is used to estimate the quantity of the natural pest enemies that should be introduced into the pest infested environment to suppress the pest population density to an economically acceptable level within a prescribed number of days. The results obtained illustrate the effect of different combinations of parasitoid wasps, using the Pascal distribution to estimate their success in parasitizing different pest developmental stages, to deliver pest control to a sustainable level. Effective control, within a prescribed number of days, is established by the deployment of two or all three species of wasps, which partially destroy pest: egg, larvae and pupae stages. The selected scenarios demonstrate effective sustainable control of the pest in less than thirty days.

29
9997958
Study on Rural Landscape Design Method under the Background of the Population Diversification
Abstract:

Population diversification phenomena becomes quite common in villages located in China’s developed coastal area. Based on the analysis of the traditional rural society and its landscape characteristics, and in consideration of diversified landscape requirements due to the population diversification, with dual ideas of heritage and innovation, methods for rural landscape design were explored by taking Duxuao Village in Zhejiang Province of China as an example.

28
9997672
Looking for a Favorable Central Place for the Establishment of Educational and Health Care Centre to Equally Facilitate Both Genders in Taluka Kunri of District Umerkot, Sindh, Pakistan
Abstract:

Population in rural areas are scattered in the form of different villages or settlements. The proper selection of land to launch any educational or health activities to equally facilitate both the genders is the sticky situation, both for Govt. and Private organizations. Govt. spends substantial funds for the establishment of education institution/health centre at the place which is feasible and accessible to general public. However for specific gender, the gender population is also considered so that both the gender may be benefited equally. In this research, efforts have been made to illustrate how one can choose or locate the best central place/ area in Taluka Kunri of district Umerkot Sindh Pakistan where the Educational or Health activity is to be initiated. For the purpose the concept of centre of mass theorem is used as a tool to develop mathematical model, subsequently utilize in achieving the objectives.


Vol:13 No:12 2019Vol:13 No:11 2019Vol:13 No:10 2019Vol:13 No:09 2019Vol:13 No:08 2019Vol:13 No:07 2019Vol:13 No:06 2019Vol:13 No:05 2019Vol:13 No:04 2019Vol:13 No:03 2019Vol:13 No:02 2019Vol:13 No:01 2019
Vol:12 No:12 2018Vol:12 No:11 2018Vol:12 No:10 2018Vol:12 No:09 2018Vol:12 No:08 2018Vol:12 No:07 2018Vol:12 No:06 2018Vol:12 No:05 2018Vol:12 No:04 2018Vol:12 No:03 2018Vol:12 No:02 2018Vol:12 No:01 2018
Vol:11 No:12 2017Vol:11 No:11 2017Vol:11 No:10 2017Vol:11 No:09 2017Vol:11 No:08 2017Vol:11 No:07 2017Vol:11 No:06 2017Vol:11 No:05 2017Vol:11 No:04 2017Vol:11 No:03 2017Vol:11 No:02 2017Vol:11 No:01 2017
Vol:10 No:12 2016Vol:10 No:11 2016Vol:10 No:10 2016Vol:10 No:09 2016Vol:10 No:08 2016Vol:10 No:07 2016Vol:10 No:06 2016Vol:10 No:05 2016Vol:10 No:04 2016Vol:10 No:03 2016Vol:10 No:02 2016Vol:10 No:01 2016
Vol:9 No:12 2015Vol:9 No:11 2015Vol:9 No:10 2015Vol:9 No:09 2015Vol:9 No:08 2015Vol:9 No:07 2015Vol:9 No:06 2015Vol:9 No:05 2015Vol:9 No:04 2015Vol:9 No:03 2015Vol:9 No:02 2015Vol:9 No:01 2015
Vol:8 No:12 2014Vol:8 No:11 2014Vol:8 No:10 2014Vol:8 No:09 2014Vol:8 No:08 2014Vol:8 No:07 2014Vol:8 No:06 2014Vol:8 No:05 2014Vol:8 No:04 2014Vol:8 No:03 2014Vol:8 No:02 2014Vol:8 No:01 2014
Vol:7 No:12 2013Vol:7 No:11 2013Vol:7 No:10 2013Vol:7 No:09 2013Vol:7 No:08 2013Vol:7 No:07 2013Vol:7 No:06 2013Vol:7 No:05 2013Vol:7 No:04 2013Vol:7 No:03 2013Vol:7 No:02 2013Vol:7 No:01 2013
Vol:6 No:12 2012Vol:6 No:11 2012Vol:6 No:10 2012Vol:6 No:09 2012Vol:6 No:08 2012Vol:6 No:07 2012Vol:6 No:06 2012Vol:6 No:05 2012Vol:6 No:04 2012Vol:6 No:03 2012Vol:6 No:02 2012Vol:6 No:01 2012
Vol:5 No:12 2011Vol:5 No:11 2011Vol:5 No:10 2011Vol:5 No:09 2011Vol:5 No:08 2011Vol:5 No:07 2011Vol:5 No:06 2011Vol:5 No:05 2011Vol:5 No:04 2011Vol:5 No:03 2011Vol:5 No:02 2011Vol:5 No:01 2011
Vol:4 No:12 2010Vol:4 No:11 2010Vol:4 No:10 2010Vol:4 No:09 2010Vol:4 No:08 2010Vol:4 No:07 2010Vol:4 No:06 2010Vol:4 No:05 2010Vol:4 No:04 2010Vol:4 No:03 2010Vol:4 No:02 2010Vol:4 No:01 2010
Vol:3 No:12 2009Vol:3 No:11 2009Vol:3 No:10 2009Vol:3 No:09 2009Vol:3 No:08 2009Vol:3 No:07 2009Vol:3 No:06 2009Vol:3 No:05 2009Vol:3 No:04 2009Vol:3 No:03 2009Vol:3 No:02 2009Vol:3 No:01 2009
Vol:2 No:12 2008Vol:2 No:11 2008Vol:2 No:10 2008Vol:2 No:09 2008Vol:2 No:08 2008Vol:2 No:07 2008Vol:2 No:06 2008Vol:2 No:05 2008Vol:2 No:04 2008Vol:2 No:03 2008Vol:2 No:02 2008Vol:2 No:01 2008
Vol:1 No:12 2007Vol:1 No:11 2007Vol:1 No:10 2007Vol:1 No:09 2007Vol:1 No:08 2007Vol:1 No:07 2007Vol:1 No:06 2007Vol:1 No:05 2007Vol:1 No:04 2007Vol:1 No:03 2007Vol:1 No:02 2007Vol:1 No:01 2007