Open Science Research Excellence

Open Science Index

Commenced in January 2007 Frequency: Monthly Edition: International Abstract Count: 66741

200
71018
Macronutrients and the FTO Gene Expression in Hypothalamus: A Systematic Review of Experimental Studies
Authors:
Abstract:
The various studies have examined the relationship between FTO gene expression and macronutrients levels. In order to obtain better viewpoint from this interactions, all of the existing studies were reviewed systematically. All published papers have been obtained and reviewed using standard and sensitive keywords from databases such as CINAHL, Embase, PubMed, PsycInfo, and the Cochrane, from 1990 to 2016. The results indicated that all of 6 studies that met the inclusion criteria (from a total of 428 published article) found FTO gene expression changes at short-term follow-ups. Four of six studies found an increased FTO gene expression after calorie restriction, while two of them indicated decreased FTO gene expression. The effect of protein, carbohydrate and fat were separately assessed and suggested by all of six studies. In conclusion, the level of FTO gene expression in hypothalamus is related to macronutrients levels. Future research should evaluate the long-term impact of dietary interventions.
199
72889
Finding Bicluster on Gene Expression Data of Lymphoma Based on Singular Value Decomposition and Hierarchical Clustering
Abstract:
DNA microarray technology is used to analyze thousand gene expression data simultaneously and a very important task for drug development and test, function annotation, and cancer diagnosis. Various clustering methods have been used for analyzing gene expression data. However, when analyzing very large and heterogeneous collections of gene expression data, conventional clustering methods often cannot produce a satisfactory solution. Biclustering algorithm has been used as an alternative approach to identifying structures from gene expression data. In this paper, we introduce a transform technique based on singular value decomposition to identify normalized matrix of gene expression data followed by Mixed-Clustering algorithm and the Lift algorithm, inspired in the node-deletion and node-addition phases proposed by Cheng and Church based on Agglomerative Hierarchical Clustering (AHC). Experimental study on standard datasets demonstrated the effectiveness of the algorithm in gene expression data.
198
41805
Using Gene Expression Programming in Learning Process of Rough Neural Networks
Abstract:
The paper will introduce an approach where a rough sets, gene expression programming and rough neural networks are used cooperatively for learning and classification support. The Objective of gene expression programming rough neural networks (GEP-RNN) approach is to obtain new classified data with minimum error in training and testing process. Starting point of gene expression programming rough neural networks (GEP-RNN) approach is an information system and the output from this approach is a structure of rough neural networks which is including the weights and thresholds with minimum classification error.
197
23964
Application of KL Divergence for Estimation of Each Metabolic Pathway Genes
Abstract:
The development of the method to annotate unknown gene functions is an important task in bioinformatics. One of the approaches for the annotation is The identification of the metabolic pathway that genes are involved in. Gene expression data have been utilized for the identification, since gene expression data reflect various intracellular phenomena. However, it has been difficult to estimate the gene function with high accuracy. It is considered that the low accuracy of the estimation is caused by the difficulty of accurately measuring a gene expression. Even though they are measured under the same condition, the gene expressions will vary usually. In this study, we proposed a feature extraction method focusing on the variability of gene expressions to estimate the genes' metabolic pathway accurately. First, we estimated the distribution of each gene expression from replicate data. Next, we calculated the similarity between all gene pairs by KL divergence, which is a method for calculating the similarity between distributions. Finally, we utilized the similarity vectors as feature vectors and trained the multiclass SVM for identifying the genes' metabolic pathway. To evaluate our developed method, we applied the method to budding yeast and trained the multiclass SVM for identifying the seven metabolic pathways. As a result, the accuracy that calculated by our developed method was higher than the one that calculated from the raw gene expression data. Thus, our developed method combined with KL divergence is useful for identifying the genes' metabolic pathway.
196
24921
A Novel PfkB Gene Cloning and Characterization for Expression in Potato Plants
Abstract:
Potato (Solanum tuberosum) is an important cash crop and popular vegetable in Pakistan and throughout the world. Cold storage of potatoes accelerates the conversion of starch into reduced sugars (glucose and fructose). This process causes dry mass and bitter taste in the potatoes that are not acceptable to end consumers. In the current study, the phosphofructokinase B gene was cloned into the pET-30 vector for protein expression and the pCambia-1301 vector for plant expression. Amplification of a 930bp product from an E. coli strain determined the successful isolation of the phosphofructokinase B gene. Restriction digestion using NcoI and BglII along with the amplification of the 930bp product using gene specific primers confirmed the successful cloning of the PfkB gene in both vectors. The protein was expressed as a His-PfkB fusion protein. Western blot analysis confirmed the presence of the 35 Kda PfkB protein when hybridized with anti-His antibodies. The construct Fani-01 was evaluated transiently using a histochemical gus assay. The appearance of blue color in the agroinfiltrated area of potato leaves confirmed the successful expression of construct Fani-01. Further, the area displaying gus expression was evaluated for PfkB expression using ELISA. Moreover, PfkB gene expression evaluated through transient expression determined successful gene expression and highlighted its potential utilization for stable expression in potato to reduce sweetening due to long-term storage.
195
37740
Comparison between Effects of Free Curcumin and Curcumin Loaded NIPAAm-MAA Nanoparticles on Telomerase and Pinx1 Gene Expression in Lung Cancer Cells
Abstract:
Herbal compounds such as curcumin which decrease telomerase and gene expression have been considered as beneficial tools for lung cancer treatment. In this article, we compared the effects of pure curcumin and curcumin-loaded NIPAAm-MAA nanoparticles on telomerase and PinX1 gene expression in a lung cancer cell line. A tetrazolium-based assay was used for determination of cytotoxic effects of curcumin on the Calu-6 lung cancer cell line and telomerase and pinX1 gene expression was measured with real-time PCR. MTT assay showed that Curcumin-loaded NIPAAm-MAA inhibited the growth of the Calu-6 lung cancer cell line in a time and dose-dependent manner. Our q-PCR results showed that the expression of telomerase gene was effectively reduced as the concentration of curcumin-loaded NIPAAm-MAA increased while expression of the PinX1 gene became elevated. The results showed that curcumin loaded NIPAAm-MAA exerted cytotoxic effects on the Calu-6 cell line through down-regulation of telomerase and stimulation of pinX1 gene expression. NIPPAm-MAA could be the good carrier for such kinds of hydrophobic agent.
194
129027
Analysis of Expression Data Using Unsupervised Techniques
Abstract:
his study was conducted to review and identify the unsupervised techniques that can be employed to analyze gene expression data in order to identify better subtypes of tumors. Identifying subtypes of cancer help in improving the efficacy and reducing the toxicity of the treatments by identifying clues to find target therapeutics. Process of gene expression data analysis described under three steps as preprocessing, clustering, and cluster validation. Feature selection is important since the genomic data are high dimensional with a large number of features compared to samples. Hierarchical clustering and K Means are often used in the analysis of gene expression data. There are several cluster validation techniques used in validating the clusters. Heatmaps are an effective external validation method that allows comparing the identified classes with clinical variables and visual analysis of the classes.
193
63300
Pathway and Differential Gene Expression Studies for Colorectal Cancer
Abstract:
Colorectal cancer (CRC) imposes serious mortality burden worldwide and it has been increasing for past consecutive years. Continuous efforts have been made so far to diagnose the disease condition and to identify the root cause for it. In this study, we performed the pathway level as well as the differential gene expression studies for CRC. We analyzed the gene expression profile GSE24514 from Gene Expression Omnibus (GEO) along with the gene pathways involved in the CRC. This analysis helps us to understand the behavior of the genes that have shown differential expression through their targeted pathways. Pathway analysis for the targeted genes covers the wider area which therefore decreases the possibility to miss the significant ones. This will prove to be beneficial to expose the ones that have not been given attention so far. Through this analysis, we attempt to understand the various neighboring genes that have close relationship to the targeted one and thus proved to be significantly controlling the CRC. It is anticipated that the identified hub and neighboring genes will provide new directions to look at the pathway level differently and will be crucial for the regulatory processes of the disease.
192
15175
Wt1 and FoxL2 Genes Expression Pattern in Mesonephros-Gonad Complexes of Green Sea Turtle (Chelonia mydas) Embryos Incubated in Feminization and Masculinization Temperature
Abstract:
Green turtle (Chelonia mydas) is one of TSD (Temperature-dependent Sex Determination, TSD) animals which sex is determined by the egg’s incubation temperature. GSD (Genotypic Sex Determination) homologous genes such as Wilms’ Tumor (Wt1) and Forkhead Box L2 (FoxL2) play a role in TSD animal sex determination process. Wt1 plays a role in both male pathway, as a transcription factor for Sf1 gene and in female pathway, as a transcription factor for Dax1. FoxL2 plays a role specifically in female sex determination, and known as transcriptional factor for Aromatase gene. Until now, research on the pattern of Wt1 and FoxL2 genes expression in C.mydas has not been conducted yet. The aim of this research is to know the pattern of Wt1 and FoxL2 genes expression in Mesonephros-Gonad (MG) complexes of Chelonia mydas embryos incubated in masculinizing temperature (MT) and feminizing temperature (FT). Eggs of C.mydas incubated in 3 different stage of TSP (Thermosensitive Period) at masculinizing temperature (26±10C, MT) and feminizing temperature (31±10C FT). Mesonefros-gonad complexes were isolated at Pre-TSP stage (FT at days 14th, MT at days 24th), TSP stage (FT at days 24th, MT at days 36th) and differentiated stage (FT at days 40th, MT at days 58th). RNA from mesonephros-gonad (MG) complexes were converted into cDNA by RT-PCR process, and the pattern of Wt1 and FoxL2 genes expression is analyzed by quantitative Real Time PCR (qPCR) method, β-actin gene is used as an internal control. The pattern of Wt1 gene expression in Pre-TSP stage was almost the same between MG complexes incubated at MT or FT, while TSP and differentiation stage, the pattern of Wt1 gene expression in MG complexes incubated at MT or FT was increased. Wt1 gene expression of MG complexes that incubated at FT was higher than at MT. There was a difference pattern between Wt1 gene expression in this research compared to the previous research in protein level. It could be assumed that the difference caused by post-transcriptional regulation mechanisms before mRNA of Wt1 gene translated into protein structure. The pattern of FoxL2 gene expression in Pre-TSP stage was almost the same between MG complexes that incubated at MT and FT, and increased in both TSP and differentiated stage. The FoxL2 gene expression in MG complexes that incubated in FT is higher than MT on TSP and differentiated stage. Based on the results of this research, it can be assumed that Wt1 and FoxL2 gene were expressed in MG complexes that incubated both at MT and FT since Pre-TSP stage. The pattern of Wt1 gene expression was increased in every stage of gonadal development, and so do the pattern of FoxL2 gene expression. Wt1 and FoxL2 gene expressions were higher in MG complexes incubated at FT than MT.
191
8991
A Review of Effective Gene Selection Methods for Cancer Classification Using Microarray Gene Expression Profile
Abstract:
Cancer is one of the dreadful diseases, which causes considerable death rate in humans. DNA microarray-based gene expression profiling has been emerged as an efficient technique for cancer classification, as well as for diagnosis, prognosis, and treatment purposes. In recent years, a DNA microarray technique has gained more attraction in both scientific and in industrial fields. It is important to determine the informative genes that cause cancer to improve early cancer diagnosis and to give effective chemotherapy treatment. In order to gain deep insight into the cancer classification problem, it is necessary to take a closer look at the proposed gene selection methods. We believe that they should be an integral preprocessing step for cancer classification. Furthermore, finding an accurate gene selection method is a very significant issue in a cancer classification area because it reduces the dimensionality of microarray dataset and selects informative genes. In this paper, we classify and review the state-of-art gene selection methods. We proceed by evaluating the performance of each gene selection approach based on their classification accuracy and number of informative genes. In our evaluation, we will use four benchmark microarray datasets for the cancer diagnosis (leukemia, colon, lung, and prostate). In addition, we compare the performance of gene selection method to investigate the effective gene selection method that has the ability to identify a small set of marker genes, and ensure high cancer classification accuracy. To the best of our knowledge, this is the first attempt to compare gene selection approaches for cancer classification using microarray gene expression profile.
190
73794
Robustness Conditions for the Establishment of Stationary Patterns of Drosophila Segmentation Gene Expression
Abstract:
First manifestation of a segmentation pattern in the early Drosophila development is the formation of expression domains (along with the main embryo axis) of genes belonging to the trunk gene class. Highly variable expression of genes from gap family in early Drosophila embryo is strongly reduced by the start of gastrulation due to the gene cross-regulation. The dynamics of gene expression is described by a gene circuit model for a system of four gap genes. It is shown that for the formation of a steep and stationary border by the model it is necessary that there existed a nucleus (modeling point) in which the gene expression level is constant in time and hence is described by a stationary equation. All the rest genes expressed in this nucleus are in a dynamic equilibrium. The mechanism of border formation associated with the existence of a stationary nucleus is also confirmed by the experiment. An important advantage of this approach is that properties of the system in a stationary nucleus are described by algebraic equations and can be easily handled analytically. Thus we explicitly characterize the cross-regulation properties necessary for the robustness and formulate the conditions providing this effect through the properties of the initial input data. It is shown that our formally derived conditions are satisfied for the previously published model solutions.
189
27523
An Analysis on Clustering Based Gene Selection and Classification for Gene Expression Data
Abstract:
Due to recent advances in DNA microarray technology, it is now feasible to obtain gene expression profiles of tissue samples at relatively low costs. Many scientists around the world use the advantage of this gene profiling to characterize complex biological circumstances and diseases. Microarray techniques that are used in genome-wide gene expression and genome mutation analysis help scientists and physicians in understanding of the pathophysiological mechanisms, in diagnoses and prognoses, and choosing treatment plans. DNA microarray technology has now made it possible to simultaneously monitor the expression levels of thousands of genes during important biological processes and across collections of related samples. Elucidating the patterns hidden in gene expression data offers a tremendous opportunity for an enhanced understanding of functional genomics. However, the large number of genes and the complexity of biological networks greatly increase the challenges of comprehending and interpreting the resulting mass of data, which often consists of millions of measurements. A first step toward addressing this challenge is the use of clustering techniques, which is essential in the data mining process to reveal natural structures and identify interesting patterns in the underlying data. This work presents an analysis of several clustering algorithms proposed to deals with the gene expression data effectively. The existing clustering algorithms like Support Vector Machine (SVM), K-means algorithm and evolutionary algorithm etc. are analyzed thoroughly to identify the advantages and limitations. The performance evaluation of the existing algorithms is carried out to determine the best approach. In order to improve the classification performance of the best approach in terms of Accuracy, Convergence Behavior and processing time, a hybrid clustering based optimization approach has been proposed.
188
96914
The Expression of Lipoprotein Lipase Gene with Fat Accumulations and Serum Biochemical Levels in Betong (KU Line) and Broiler Chickens
Abstract:
Betong chicken is a slow growing and a lean strain of chicken, while the rapid growth of broiler is accompanied by increased fat. We investigated the growth performance, fat accumulations, lipid serum biochemical levels and lipoprotein lipase (LPL) gene expression of female Betong (KU line) at the age of 4 and 6 weeks. A total of 80 female Betong chickens (KU line) and 80 female broiler chickens were reared under open system (each group had 4 replicates of 20 chicks per pen). The results showed that feed intake and average daily gain (ADG) of broiler chicken were significantly higher than Betong (KU line) (P < 0.01), while feed conversion ratio (FCR) of Betong (KU line) at week 6 were significantly lower than broiler chicken (P < 0.01) at 6 weeks. At 4 and 6 weeks, two birds per replicate were randomly selected and slaughtered. Carcass weight did not significantly differ between treatments; the percentage of abdominal fat and subcutaneous fat yield was higher in the broiler (P < 0.01) at 4 and 6 week. Total cholesterol and LDL level of broiler were higher than Betong (KU line) at 4 and 6 weeks (P < 0.05). Abdominal fat samples were collected for total RNA extraction. The cDNA was amplified using primers specific for LPL gene expression and analysed using real-time PCR. The results showed that the expression of LPL gene was not different when compared between Betong (KU line) and broiler chickens at the age of 4 and 6 weeks (P > 0.05). Our results indicated that broiler chickens had high growth rate and fat accumulation when compared with Betong (KU line) chickens, whereas LPL gene expression did not differ between breeds.
187
9022
An Analysis System for Integrating High-Throughput Transcript Abundance Data with Metabolic Pathways in Green Algae
Abstract:
As the most important non-vascular plants, algae have many research applications, including high species diversity, biofuel sources, adsorption of heavy metals and, following processing, health supplements. With the increasing availability of next-generation sequencing (NGS) data for algae genomes and transcriptomes, an integrated resource for retrieving gene expression data and metabolic pathway is essential for functional analysis and systems biology in algae. However, gene expression profiles and biological pathways are displayed separately in current resources, and making it impossible to search current databases directly to identify the cellular response mechanisms. Therefore, this work develops a novel AlgaePath database to retrieve gene expression profiles efficiently under various conditions in numerous metabolic pathways. AlgaePath, a web-based database, integrates gene information, biological pathways, and next-generation sequencing (NGS) datasets in Chlamydomonasreinhardtii and Neodesmus sp. UTEX 2219-4. Users can identify gene expression profiles and pathway information by using five query pages (i.e. Gene Search, Pathway Search, Differentially Expressed Genes (DEGs) Search, Gene Group Analysis, and Co-Expression Analysis). The gene expression data of 45 and 4 samples can be obtained directly on pathway maps in C. reinhardtii and Neodesmus sp. UTEX 2219-4, respectively. Genes that are differentially expressed between two conditions can be identified in Folds Search. Furthermore, the Gene Group Analysis of AlgaePath includes pathway enrichment analysis, and can easily compare the gene expression profiles of functionally related genes in a map. Finally, Co-Expression Analysis provides co-expressed transcripts of a target gene. The analysis results provide a valuable reference for designing further experiments and elucidating critical mechanisms from high-throughput data. More than an effective interface to clarify the transcript response mechanisms in different metabolic pathways under various conditions, AlgaePath is also a data mining system to identify critical mechanisms based on high-throughput sequencing.
186
74607
Construction of the Large Scale Biological Networks from Microarrays
Authors:
Abstract:
One of the sustainable goals of the system biology is understanding gene-gene interactions. Hence, gene regulatory networks (GRN) need to be constructed for understanding the disease ontology and to reduce the cost of drug development. To construct gene regulatory from gene expression we need to overcome many challenges such as data denoising and dimensionality. In this paper, we develop an integrated system to reduce data dimension and remove the noise. The generated network from our system was validated via available interaction databases and was compared to previous methods. The result revealed the performance of our proposed method.
185
132643
Construction of a Fusion Gene Carrying E10A and K5 with 2A Peptide-Linked by Using Overlap Extension PCR
Authors:
Abstract:
E10A is a kind of replication-defective adenovirus which carries the human endostatin gene to inhibit the growth of tumors. Kringle 5(K5) has almost the same function as angiostatin to also inhibit the growth of tumors since they are all the byproduct of the proteolytic cleavage of plasminogen. Tumor size increasing can be suppressed because both of the endostatin and K5 can restrain the angiogenesis process. Therefore, in order to improve the treatment effect on tumor, 2A peptide is used to construct a fusion gene carrying both E10A and K5. Using 2A peptide is an ideal strategy when a fusion gene is expressed because it can avoid many problems during the expression of more than one kind of protein. The overlap extension PCR is also used to connect 2A peptide with E10A and K5. The final construction of fusion gene E10A-2A-K5 can provide a possible new method of the anti-angiogenesis treatment with a better expression performance.
184
35990
The Identification of Combined Genomic Expressions as a Diagnostic Factor for Oral Squamous Cell Carcinoma
Authors:
Abstract:
Trends in genetics are transforming in order to identify differential coexpressions of correlated gene expression rather than the significant individual gene. Moreover, it is known that a combined biomarker pattern improves the discrimination of a specific cancer. The identification of the combined biomarker is also necessary for the early detection of invasive oral squamous cell carcinoma (OSCC). To identify the combined biomarker that could improve the discrimination of OSCC, we explored an appropriate number of genes in a combined gene set in order to attain the highest level of accuracy. After detecting a significant gene set, including the pre-defined number of genes, a combined expression was identified using the weights of genes in a gene set. We used the Principal Component Analysis (PCA) for the weight calculation. In this process, we used three public microarray datasets. One dataset was used for identifying the combined biomarker, and the other two datasets were used for validation. The discrimination accuracy was measured by the out-of-bag (OOB) error. There was no relation between the significance and the discrimination accuracy in each individual gene. The identified gene set included both significant and insignificant genes. One of the most significant gene sets in the classification of normal and OSCC included MMP1, SOCS3 and ACOX1. Furthermore, in the case of oral dysplasia and OSCC discrimination, two combined biomarkers were identified. The combined genomic expression achieved better performance in the discrimination of different conditions than in a single significant gene. Therefore, it could be expected that accurate diagnosis for cancer could be possible with a combined biomarker.
183
87401
Study on Developmental and Pathogenesis Related Genes Expression Deregulation in Brassica compestris Infected with 16Sr-IX Associated Phytoplasma
Abstract:
Phytoplasmas are phloem-inhibited plant pathogenic bacteria that are transferred by insect vectors. Among biotic factors, Phytoplasma infection induces abnormality influencing the physiology as well as morphology of plants. In 16Sr-IX group phytoplasma-infected brassica compestris, flower abnormalities have been associated with changes in the expression of floral development genes. To determine whether methylation was involved in down-regulation of flower development, the process of DNA methylation and Demethylation was investigated as a possible mechanism for regulation of floral gene expression in phytoplasma infected Brassica transmitted by Orosious orientalis vector by using RT-PCR, MSRE-PCR, Southern blotting, Bisulfite Sequencing, etc. Transcriptional expression of methylated genes was found to be globally down-regulated in plants infected with phytoplasma, but not severely in those infested by insect vectors and variation in expression was found in genes involved in methylation. These results also showed that genes particularly orthologous to Arabidopsis APETALA3 involved in petal formation and flower development was down-regulated severely in phytoplasma-infected brassica and with the fact that phytoplasma and insect induce variation in developmental gene expression. The DNA methylation status of flower developmental gene in phytoplasma infected plants with 5-azacytidine restored gene expression strongly suggesting that DNA methylation was involved in down-regulation of floral development genes in phytoplasma infected brassica.
182
43003
Cloning and Expression of Human Interleukin 15: A Promising Candidate for Cytokine Immunotherapy
Authors:
Abstract:
Recombinant cytokines have been employed successfully as potential therapeutic agent. Some cytokine therapies are already used as a part of clinical practice, ranging from early exploratory trials to well established therapies that have already received approval. Interleukin 15 is a pleiotropic cytokine having multiple roles in peripheral innate and adaptive immune cell function. It regulates the activation, proliferation and maturation of NK cells, T-cells, monocytes/macrophages and granulocytes, and the interactions between them thus acting as a bridge between innate and adaptive immune responses. Unraveling the biology of IL-15 has revealed some interesting surprises that may point toward some of the first therapeutic applications for this cytokine. In this study, the human interleukin 15 gene was isolated, amplified and ligated to a TA vector which was then transfected to a bacterial host, E. coli Top10F’. The sequence of cloned gene was confirmed and it showed 100% homology with the reported sequence. The confirmed gene was then subcloned in pET Expression system to study the IPTG induced expression of IL-15 gene. Positive expression was obtained for number of clones that showed 15 kd band of IL-15 in SDS-PAGE analysis, indicating the successful strain development that can be studied further to assess the potential therapeutic intervention of this cytokine in relevance to human diseases.
181
111706
The Expression of Toll-Like Receptors Gene in Peripheral Blood Mononuclear Cells of Betong (KU Line) Chicken
Abstract:
Toll-like receptors (TLR) are conserved microbial sensing receptors located on cell surface that are able to detect different pathogens. The aim of the present study is to examine the expression of TLR gene in peripheral blood mononuclear cell of Betong (KU line) chicken. Blood samples were collected from healthy 12 Betong (KU line) chicken. PBMCs were isolated and maintained in RPMI1640 with 10% FBS, penicillin and streptomycin. Cell viability was determined by trypan blue dye exclusion test. The expression of TLRs gene was investigated by polymerase chain reaction (PCR) technique. Results showed that PBMCs viability from Betong (KU line) chicken was 95.38 ± 1.06%. From the study of TLRs gene expression, results indicated that there are expressions of TLR1.1 TLR1.2 TLR2.1 TLR2.2 TLR3 TLR4 TLR5 TLR 7 TLR15 and TLR21 in PBMCs of Betong (KU line) chicken. In conclusion, PBMCs isolated from blood of Betong (KU line) chicken had a high cell viability ( > 95%). The expression of TLRs in chicken was all found in PBMCs, which indicated that PBMC isolated from the blood of Betong (KU line) chicken can be used as an in vitro immune responses study.
180
111231
Functional Gene Expression in Human Cells Using Linear Vectors Derived from Bacteriophage N15 Processing
Abstract:
This paper adapts the bacteriophage N15 protelomerase enzyme to assemble linear chromosomes as vectors for gene expression in human cells. Phage N15 has the unique ability to replicate as a linear plasmid with telomeres in E. coli during its prophage stage of life-cycle. The virus-encoded protelomerase enzyme cuts its circular genome and caps its ends to form hairpin telomeres, resulting in a linear human-chromosome-like structure in E. coli. In mammalian cells, however, no enzyme with TelN-like activities has been found. In this work, we show for the first-time transfer of the protelomerase from phage into human and mouse cells and demonstrate recapitulation of its activity in these hosts. The function of this enzyme is assayed by demonstrating cleavage of its target DNA, followed by detecting telomere formation based on its resistance to recBCD enzyme digestion. We show protelomerase expression persists for at least 60 days, which indicates limited silencing of its expression. Next, we show that an intact human β-globin gene delivered on this linear chromosome accurately retains its expression in the human cellular environment for at least 60 hours, demonstrating its stability and potential as a vector. These results demonstrate that the N15 protelomerse is able to function in mammalian cells to cut and heal DNA to create telomeres, which provides a new tool for creating novel structures by DNA resolution in these hosts.
179
50092
Light-Controlled Gene Expression in Yeast
Abstract:
Light as a stimulus provides the capability to develop regulation techniques for customizable gene expression. A great advantage is the extremely flexible and accurate dosing that can be performed in a non invasive and sterile manner even for high throughput technologies. Therefore, light regulation in a multiwell microbioreactor system was realized providing the opportunity to control gene expression with outstanding complexity. A light-regulated gene expression system in Saccharomyces cerevisiae was designed applying the strategy of caged compounds. These compounds are photo-labile protected and therefore biologically inactive regulator molecules which can be reactivated by irradiation with certain light conditions. The “caging” of a repressor molecule which is consumed after deprotection was essential to create a flexible expression system. Thereby, gene expression could be temporally repressed by irradiation and subsequent release of the active repressor molecule. Afterwards, the repressor molecule is consumed by the yeast cells leading to reactivation of gene expression. A yeast strain harboring a construct with the corresponding repressible promoter in combination with a fluorescent marker protein was applied in a Photo-BioLector platform which allows individual irradiation as well as online fluorescence and growth detection. This device was used to precisely control the repression duration by adjusting the amount of released repressor via different irradiation times. With the presented screening platform the regulation of complex expression procedures was achieved by combination of several repression/derepression intervals. In particular, a stepwise increase of temporally-constant expression levels was demonstrated which could be used to study concentration dependent effects on cell functions. Also linear expression rates with variable slopes could be shown representing a possible solution for challenging protein productions, whereby excessive production rates lead to misfolding or intoxication. Finally, the very flexible regulation enabled accurate control over the expression induction, although we used a repressible promoter. Summing up, the continuous online regulation of gene expression has the potential to synchronize gene expression levels to optimize metabolic flux, artificial enzyme cascades, growth rates for co cultivations and many other applications addicted to complex expression regulation. The developed light-regulated expression platform represents an innovative screening approach to find optimization potential for production processes.
178
6275
Transcriptomine: The Nuclear Receptor Signaling Transcriptome Database
Abstract:
Understanding signaling by nuclear receptors (NRs) requires an appreciation of their cognate ligand- and tissue-specific transcriptomes. While target gene regulation data are abundant in this field, they reside in hundreds of discrete publications in formats refractory to routine query and analysis and, accordingly, their full value to the NR signaling community has not been realized. One of the mandates of the Nuclear Receptor Signaling Atlas (NURSA) is to facilitate access of the community to existing public datasets. Pursuant to this mandate we are developing a freely-accessible community web resource, Transcriptomine, to bring together the sum total of available expression array and RNA-Seq data points generated by the field in a single location. Transcriptomine currently contains over 25,000,000 gene fold change datapoints from over 1200 contrasts relevant to over 100 NRs, ligands and coregulators in over 200 tissues and cell lines. Transcriptomine is designed to accommodate a spectrum of end users ranging from the bench researcher to those with advanced bioinformatic training. Visualization tools allow users to build custom charts to compare and contrast patterns of gene regulation across different tissues and in response to different ligands. Our resource affords an entirely new paradigm for leveraging gene expression data in the NR signaling field, empowering users to query gene fold changes across diverse regulatory molecules, tissues and cell lines, target genes, biological functions and disease associations, and that would otherwise be prohibitive in terms of time and effort. Transcriptomine will be regularly updated with gene lists from future genome-wide expression array and expression-sequencing datasets in the NR signaling field.
177
47435
Expression Level of Dehydration-Responsive Element Binding/DREB Gene of Some Local Corn Cultivars from Kisar Island-Maluku Indonesia Using Quantitative Real-Time PCR
Abstract:
The research objective was to determine the expression level of dehydration responsive element binding/DREB gene of local corn cultivars from Kisar Island Maluku. The study design was a randomized block design with single factor consist of six local corn cultivars obtained from farmers in Kisar Island and one reference varieties wich has been released by the government as a drought-tolerant varieties and obtained from Cereal Crops Research Institute (ICERI) Maros South Sulawesi. Leaf samples were taken is the second leaf after the flag leaf at the 65 days after planting. Isolation of total RNA from leaf samples was carried out according to the protocols of the R & A-BlueTM Total RNA Extraction Kit and was used as a template for cDNA synthesis. The making of cDNA from total RNA was carried out according to the protocol of One-Step Reverse Transcriptase PCR Premix Kit. Real Time-PCR was performed on cDNA from reverse transcription followed the procedures of Real MODTM Green Real-Time PCR Master Mix Kit. Data obtained from the real time-PCR results were analyzed using relative quantification method based on the critical point / Cycle Threshold (CP / CT). The results of gene expression analysis of DREB gene showed that the expression level of the gene was highest obtained at Deep Yellow local corn cultivar, and the lowest one was obtained at the Rubby Brown Cob cultivar. It can be concluded that the expression level of DREB gene of Deep Yellow local corn cultivar was highest than other local corn cultivars and Srikandi variety as a reference variety.
176
71047
Paper-Based Detection Using Synthetic Gene Circuits
Abstract:
Paper-based synthetic gene circuits offer a new paradigm for programmable, fieldable biodetection. We demonstrate that by freeze-drying gene circuits with in vitro expression machinery, we can use complimentary RNA sequences to trigger colorimetric changes upon rehydration. We have successfully utilized both green fluorescent protein and luciferase-based reporters for easy visualization purposes in solution. Through several efforts, we are aiming to use this new platform technology to address a variety of needs in portable detection by demonstrating several more expression and reporter systems for detection functions on paper. In addition to RNA-based biodetection, we are exploring the use of various mechanisms that cells use to respond to environmental conditions to move towards all-hazards detection. Examples include explosives, heavy metals for water quality, and toxic chemicals.
175
20248
mRNA Expression of NFKB1 with Parkinson's Disease
Abstract:
The aim of the present study was to investigate the expression levels of homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells 1, transcript variant 1 (NFKB1*1) mRNA in the peripheral blood of patients with Parkinson to elucidate the role in the pathogenesis of Parkinson disease (PD). The study group comprised 50 patients with the diagnosis of PD who have applied to Gaziantep University Faculty of Medicine, and Department of Neurology. 50 healthy individuals without any neuro degenerative disease are included as controls. Ribonucleic acid (RNA) was obtained from blood samples of patient and control groups. Complementary deoxyribonucleic acid (cDNA) was obtained from RNA samples using reverse transcription polymerase chain reaction (RT-PCR) technique. The gene expression of NFKB1*1 in patient/control groups were observed to decrease significantly, and the differences between groups with the Mann-Whitney method within 95% confidence interval (p< 0.05) were analyzed. This salient finding provide a clue for our hypothesis that reduced activity of NFKB1*1 gene might play a role, at least partly, in the pathophysiology of PD.
174
24878
Expression of uPA, tPA, and PAI-1 in Calcified Aortic Valves
Abstract:
Our physiopathological assumption is that u-PA, t-PA, and PAI-1 are released by calcified aortic valves and play a role in the calcification of these valves. Sixty-five calcified aortic valves were collected from patients suffering from aortic stenosis. Each valve was incubated for 24 hours in culture medium. The supernatants were used to measure u-PA, t-PA, and PAI-1 concentrations; the valve calcification was evaluated using biphotonic absorptiometry. Aortic stenosis valves expressed normal plasminogen activators concentrations and overexpressed PAI-1 (u-PA, t-PA, and PAI-1 mean concentrations were, resp., 1.69 ng/mL ± 0.80, 2.76 ng/mL ± 1.33, and 53.27 ng/mL ± 36.39). There was no correlation between u-PA and PAI-1 (r = 0.3) but t-PA and PAI-1 were strongly correlated with each other (r = 0.6). Over expression of PAI-1 was proportional to the calcium content of theAS valves. Our results demonstrate a consistent increase of PAI-1 proportional to the calcification. The over expression of PAI-1 may be useful as a predictive indicator in patients with aortic stenosis.
173
16818
Effect of Follicular Fluid on in vitro Maturation and Gene Expression in Ovine Oocytes
Abstract:
The aim of the present study was to evaluate the effect of ovine follicular fluid supplementation during IVM of sheep oocytes on the resumption of meiosis, glutathione (GSH) content and expression of Bax, Bcl-2, and HSPB1 genes. Sheep ovaries were collected from Riyadh slaughterhouse, KSA. Oocytes were aspirated from 3-6 mm follicles. Ovine oocytes were cultured in maturation medium with 0% (control), 10%, 20%, 40% of ovine follicular fluid for 24 h. Results indicated that the rate of oocyte maturation was significantly (P≤0.05) decreased in 40% OFF (36.87%) versus the control (61.3%), 10% OFF (63.95%) and 20% OFF (64.08%). Supplementation of 10% OFF to IVM medium induced an intra-oocyte GSH concentration significantly higher than that found in ovine oocytes cultured with 20% OFF and 40% OFF and similar to the GSH content in oocytes cultured without FF. Real time polymerase chain reaction analysis for gene expression revealed no differences in Bax, Bcl-2, HSPB1 genes between control and 10% OFF group, whereas they were strongly expressed in 20% OFF and 40% OFF (P < 0.05) when compared to the control and 10% OFF. In conclusion the addition of 10% OFF to the IVM culture of sheep oocytes is recommended to support cytoplasmic maturation and increase oocytes competence.
172
77765
Transcriptomic Response of Calmodulin Encoding Gene (CaM) in Pesticide Utilizing Talaromyces Fungal Strains
Abstract:
Calmodulin is one of the intracellular calcium proteins that regulates large spectrum of enzymes and cellular functions including metabolism of cyclic nucleotides and glycogen. The potentials of calmodulin gene in fungi necessitates their genetic response and their strong cassette of enzyme secretions for pesticide degradation. Therefore, this study was carried out to investigate the ‘Transcriptomic’ response of calmodulin encoding genes in Talaromyces fungi in response to 2, 2-dichlorovinyl dimethyl phosphate (DDVP or Dichlorvos) an organophosphate pesticide and γ-Hexachlorocyclohexane (Lindane) an organochlorine pesticide. Fungi strains isolated from rhizosphere from grasses rhizosphere in pesticide polluted sites were subjected to percentage incidence test. Two most frequent fungi were further characterized using ITS gene amplification (ITS1 and ITS4 combinations), they were thereafter subjected to In-vitro DDVP and lindane tolerance tests at different concentrations. They were also screened for presence and expression of calmodulin gene (caM) using RT-PCR technique. The two Talaromyces strains had the highest incidence of 50-72% in pesticide polluted site, they were both identified as Talaromyces astroroseus asemoG and Talaromyces purpurogenum asemoN submitted in NCBI gene-bank with accession numbers KY488464 and KY488468 respectively. T. astroroseus KY488464 tolerated DDVP (1.23±0.023 cm) and lindane (1.11±0.018 cm) at 25 % concentration while T. purpurogenum KY488468 tolerated DDVP (1.33±0.061 cm) and lindane (1.54±0.077 cm) at this concentration. Calmodulin gene was detected in both strains, but RT-PCR expression of caM gene revealed at 900-1000 bp showed an under-expression of caM in T. astrorosues KY488464 but overexpressed in T. purpurogenum KY488464. Thus, the calmodulin gene response of these fungal strains to both pesticides could be considered in monitoring the potentials of fungal strains to pesticide tolerance and bioremediation of pesticide in polluted soil.
171
74487
Modulation of Lipopolysaccharide Induced Interleukin-17F and Cyclooxygenase-2 Gene Expression by Echinacea purpurea in Broiler Chickens
Abstract:
This study was conducted to evaluate the effect of Echinacea purpurea on the expression of cyclooxygenase-2 (COX-2), interleukin-17F (IL-17F) in seven-day-old broiler chickens. Four groups were fed with concentration of 0 g/kg, 5 g/kg, 10 g/kg and 20 g/kg from the root of E. purpurea in the basal diet and two other groups were only fed with the basal diet for 21 days. At the 28th day, lipopolysaccharide (LPS, 2 mg/kg diet) was injected in four groups and the basal diet group was injected by saline as control. The chickens&rsquo; spleen RNA expression was measured for the COX-2 and IL-17F genes by Real-Time PCR. The results have shown that chickens which were fed E. purpurea had a lower COX-2 and IL-17F mRNA expression. The chickens who have received LPS only, lymphocyte was lower than other treatments. Vital organ weights were not significantly different, but body weight loss was recovered by dietary herbs inclusion. The results of this study have shown the positive effect of an anti-inflammatory herb to prevent the undesirable effect of inflammation.
170
79033
Profile of Programmed Death Ligand-1 (PD-L1) Expression and PD-L1 Gene Amplification in Indonesian Colorectal Cancer Patients
Abstract:
The presence of the programmed death ligand-1 (PD-L1) has been used in multiple clinical trials and approved as biomarker for selecting patients more likely to respond to immune checkpoint inhibitors. However, the expression of PD-L1 is regulated in different ways, which leads to a different significance of its presence. Positive PD-L1 within tumors may result from two mechanisms, induced PD-L1 expression by T-cell presence or genetic mechanism that lead to constitutive PD-L1 expression. Amplification of PD-L1 genes was found as one of genetic mechanism which causes an increase in PD-L1 expression. In case of colorectal cancer (CRC), targeting immune checkpoint inhibitor has been recommended for patients with microsatellite instable (MSI). Although the correlation between PD-L1 expression and MSI status has been widely studied, so far the precise mechanism of PD-L1 gene activation in CRC patients, particularly in MSI population have yet to be clarified. In this present study we have profiled 61 archived formalin fixed paraffin embedded CRC specimens of patients from Medistra Hospital, Jakarta admitted in 2010 - 2016. Immunohistochemistry was performed to measure expression of PD-L1 in tumor cells as well as MSI status using antibodies against PD-L1 and MMR (MLH1, MSH2, PMS2 and MSH6), respectively. PD-L1 expression was measured on tumor cells with cut off of 1% whereas loss of nuclear MMR protein expressions in tumor cells but not in normal or stromal cells indicated presence of MSI. Subset of PD-L1 positive patients was then assessed for copy number variations (CNVs) using single Tube TaqMan Copy Number Assays Gene CD247PD-L1. We also observed KRAS mutation to profile possible genetic mechanism leading to the presence or absence of PD-L1 expression. Analysis of 61 CRC patients revealed 15 patients (24%) expressed PD-L1 on their tumor cell membranes. The prevalence of surface membrane PD-L1 was significantly higher in patients with MSI (87%; 7/8) compared to patients with microsatellite stable (MSS) (15%; 8/53) (P=0.001). Although amplification of PD-L1 gene was not found among PD-L1 positive patients, low-level amplification of PD-L1 gene was commonly observed in MSS patients (75%; 6/8) than in MSI patients (43%; 3/7). Additionally, we found 26% of CRC patients harbored KRAS mutations (16/61), so far the distribution of KRAS status did not correlate with PD-L1 expression. Our data suggest genetic mechanism through amplification of PD-L1 seems not to be the mechanism underlying upregulation of PD-L1 expression in CRC patients. However, further studies are warranted to confirm the results.
169
13261
Role of Endonuclease G in Exogenous DNA Stability in HeLa Cells
Abstract:
Endonuclease G (EndoG) is a well conserved mitochondrio-nuclear nuclease with dual lethal and vital roles in the cell. The aim of our study was to examine whether EndoG exerts its nuclease activity on exogenous DNA substrates such as plasmid DNA (pDNA), considering their importance in gene therapy applications. The effects of EndoG knockdown on pDNA stability and levels of encoded reporter gene expression were evaluated in the cervical carcinoma HeLa cells. Transfection of pDNA vectors encoding short-hairpin RNAs (shRNAs) reduced levels of EndoG mRNA and nuclease activity in HeLa cells. In physiological circumstances, EndoG knockdown did not have an effect on the stability of pDNA or the levels of encoded transgene expression as measured over a four day time-course. However, when endogenous expression of EndoG was induced by an extrinsic stimulus, targeting of EndoG by shRNA improved the perceived stability and transgene expression of pDNA vectors. Therefore, EndoG is not a mediator of exogenous DNA clearance, but in non-physiological circumstances it may non-specifically cleave intracellular DNA regardless of its origin. These findings make it unlikely that targeting of EndoG is a viable strategy for improving the duration and level of transgene expression from non-viral DNA vectors in gene therapy efforts.
168
20247
Expression of ULK-1 mRNA in Human Peripheral Blood Mononuclear Cells from Patients with Alzheimer's Disease
Abstract:
Objective: Alzheimer's disease (AD), the most common cause of dementia, is a progressive neurodegenerative disease. At present, diagnosis of AD is rather late in the disease. Therefore, we attempted to find peripheral biomarkers for the early diagnosis of AD. Herein, we conducted a study to investigate the unc-51 like autophagy activating kinase-1 (ULK1) mRNA expression levels in human peripheral blood mononuclear cells from patients with Alzheimer's disease. Method: To determine whether ULK1 gene expression are altered in AD patients, we measured their gene expression in human peripheral blood cell in 50 patients with AD and 50 age and gender matched healthy controls by quantitative real-time PCR technique. Results: We found that both ULK1 gene expression in peripheral blood cell were significantly decreased in patients with AD as compared with controls (p < 0.05). Lower levels of ULK1 gene expression were significantly associated with the increased risk for AD. Conclusions: Serine/threonine-protein kinase involved in autophagy in response to starvation. Acts upstream of phosphatidylinositol 3-kinase PIK3C3 to regulate the formation of autophagophores, the precursors of autophagosomes. Part of regulatory feedback loops in autophagy: acts both as a downstream effector and negative regulator of mammalian target of rapamycin complex 1 (mTORC1) via interaction with RPTOR. Activated via phosphorylation by AMPK and also acts as a regulator of AMPK by mediating phosphorylation of AMPK subunits PRKAA1, PRKAB2, and PRKAG1, leading to negatively regulate AMPK activity. May phosphorylate ATG13/KIAA0652 and RPTOR; however such data need additional evidences. Plays a role early in neuronal differentiation and is required for granule cell axon formation. Alzheimer is the most common neurodegenerative disease. Our results provide useful information that the ULK1 gene expression is decreased in the neurodegeneration and AD patients with, indicating their possible systemic involvement in AD.
167
104472
lncRNA Gene Expression Profiling Analysis by TCGA RNA-Seq Data of Breast Cancer
Abstract:
Introduction: Breast cancer is a heterogeneous disease that can be classified in 4 subgroups using transcriptional profiling. The role of lncRNA expression in human breast cancer biology, prognosis, and molecular classification remains unknown. Methods and results: Using an integrative comprehensive analysis of lncRNA, mRNA and DNA methylation in 900 breast cancer patients from The Cancer Genome Atlas (TCGA) project, we unraveled the molecular portraits of 1,700 expressed lncRNA. Some of those lncRNAs (i.e, HOTAIR) are previously reported and others are novel (i.e, HOTAIRM1, MAPT-AS1). The lncRNA classification correlated well with the PAM50 classification for basal-like, Her-2 enriched and luminal B subgroups, in contrast to the luminal A subgroup which behaved differently. Importantly, estrogen receptor (ESR1) expression was associated with distinct lncRNA networks in lncRNA clusters III and IV. Gene set enrichment analysis for cis- and trans-acting lncRNA showed enrichment for breast cancer signatures driven by breast cancer master regulators. Almost two third of those lncRNA were marked by enhancer chromatin modifications (i.e., H3K27ac), suggesting that lncRNA expression may result in increased activity of neighboring genes. Differential analysis of gene expression profiling data showed that lncRNA HOTAIRM1 was significantly down-regulated in basal-like subtype, and DNA methylation profiling data showed that lncRNA HOTAIRM1 was highly methylated in basal-like subtype. Thus, our integrative analysis of gene expression and DNA methylation strongly suggested that lncRNA HOTAIRM1 should be a tumor suppressor in basal-like subtype. Conclusion and significance: Our study depicts the first lncRNA molecular portrait of breast cancer and shows that lncRNA HOTAIRM1 might be a novel tumor suppressor.
166
27958
Expression of Inflammatory and Cell Death Genes and DNA Damage Induced by Endotoxic Shock in Laying Hens
Abstract:
This investigation was conducted to determine the physiological response and evaluate the expression of inflammatory and cell death genes and DNA damage induced by endotoxic shock in laying hens. Endotoxic shock was induced by a single intravenous injection of 107 Escherichia coli (E. coli,) colony/hen. In the present study, 240 forty-week-old laying hens (H&N) were randomly assigned into 2 groups with 3 replicates of 40 birds each. Hens were reared in battery cages with wire floors in an open-sided housing system under natural conditions. Housing and general management practices were similar for all groups. At 42-wk of age, 45 hens from the first group (15 replicate) were infected with E. coli, while the same number of hens from the second group was injected with saline and served as a control. Heat shock protein-70 (HSP-70) expression, plasma corticosterone concentration, body temperature, and the gene expression of bax, caspase-3 activity, P38, Interlukin-1β (Il-1β), and tumor necrosis factor alpha (TNF-α) genes and DNA damage in the brain and liver were measured. Hens treated with E. coli showed significant (P≤0.05) increase of body temperature by 1.2 ᴼC and plasma corticosterone by 3 folds compared to the controls. Further, hens injected with E.Coli showed markedly over-expression of HSP-70 and increase DNA damage in brain and liver. These results were synchronized with activating cell death program since our data showed significant (P≤0.05) high expression of bax and caspase-3 activity genes in the brain and liver. These results were related to remarkable over-inflammation gene expression of P38, IL-1β, and TNF-α in brain and liver. In conclusion, our results indicate that endotoxic shock induces inflammatory physiological response and triggers cell death program by promoting P38, IL-1β, and TNF-α gene expression in the brain and liver.
165
30831
Down-Regulated Gene Expression of GKN1 and GKN2 as Diagnostic Markers for Gastric Cancer
Abstract:
Gastric cancer (GC) has high morbidity and fatality rate in various countries and is still one of the most frequent and deadly diseases. Novel mitogenic and motogenic Gastrokine1 (GKN1) and Gastrokine 2 (GKN2) genes that are highly expressed in the normal stomach epithelium and plays an important role in maintaining the integrity and homeostasis of stomach mucosal epithelial cells. Significant loss of copy number and mRNA transcript of GKN1 and GKN2 gene expression were frequently observed in all types of gastric cancer. In this study, 47 paired samples that were grouped according to the types of gastric cancer and the clinical characteristics of the patients, including gender and average of age were investigated with gene expression analysis and mutation screening by monetering RT-PCR, SSCP and nucleotide sequencing techniques. Both GKN1 and GKN2 genes were observed significantly reduced found by (Wilcoxon signed rank test; p< 0.05). As a result of gene screening, no mutation (no different genotype) was detected. It is considered that gene mutations are not the cause of inactivation of gastrokines. In conclusion, the mRNA expression level of GKN1 and GKN2 genes statistically was decreased regardless the gender, age or cancer type of patients. Reduced of gastrokine genes seems to occur at the initial steps of cancer development. In order to understand the investigation between gastric cancer and diagnostic biomarker; further analysis is necessary.
164
24281
Effect of Deer Antler Extract on Osteogenic Gene Expression and Longitudinal Bone Growth of Adolescent Male Rats
Abstract:
Deer antler, traditionally used as a tonic and valuable drug in oriental medicine, has been considered to possess bone-strengthening activity. The upper section, mid section, and base of the antler has been known to exhibit different biological properties. Present study was performed to examine the effects of different parts of deer antler extract (DH) on osteogenic gene expressions in MG-63 cells and longitudinal bone growth in adolescent male rats. The expressions of osteogenic genes, collagen, alkaline phosphatase, osteocalcin, and osteopontin, were measured by quantitative real-time PCR. Longitudinal bone growth was measured in 3-week-old male Sprague-Dawley rats using fluorescence microscopy. To examine the effects on the growth plate metabolism, the total height of growth plate and bone morphogenetic protein-2 (BMP-2) were measured. Collagen and osteocalcin mRNA expressions were increased by all three parts of the DH treatment while osteopontin gene expression was not affected by any of the DH treatment. Alkaline phosphatase gene expression was increased by upper and mid part of DH while base part of DH fails to affect alkaline phosphatase gene expression. The upper and mid parts of the DH treatment enhanced longitudinal bone growth and total height of growth plate. The induction of BMP-2 protein expression in growth plate assessed by immunostaining was also promoted by upper and mid parts of the DH treatment. These results suggest that DH, especially upper and mid parts, stimulate osteogenic gene expressions and have the effect on bone growth in adolescent rats and might be used for the growth delayed adolescent and inherent growth failure patient.
163
35375
Analysis of NMDA Receptor 2B Subunit Gene (GRIN2B) mRNA Expression in the Peripheral Blood Mononuclear Cells of Alzheimer's Disease Patients
Abstract:
N-methyl-D-aspartate (NMDA) receptor is a subtype of glutamate receptor and plays a pivotal role in learning, memory, neuronal plasticity, neurotoxicity and synaptic mechanisms. Animal experiments were suggested that glutamate-induced excitotoxic injuriy and NMDA receptor blockage lead to amnesia and other neurodegenerative diseases including Alzheimer’s disease (AD), Huntington’s disease, amyotrophic lateral sclerosis. Aim of this study is to investigate association between NMDA receptor coding gene GRIN2B expression level and Alzheimer disease. The study was approved by the local ethics committees, and it was conducted according to the principles of the Declaration of Helsinki and guidelines for the Good Clinical Practice. Peripheral blood was collected 50 patients who diagnosed AD and 49 healthy control individuals. Total RNA was isolated with RNeasy midi kit (Qiagen) according to manufacturer’s instructions. After checked RNA quality and quantity with spectrophotometer, GRIN2B expression levels were detected by quantitative real time PCR (QRT-PCR). Statistical analyses were performed, variance between two groups were compared with Mann Whitney U test in GraphpadInstat algorithm with 95 % confidence interval and p < 0.05. After statistical analyses, we have determined that GRIN2B expression levels were down regulated in AD patients group with respect to control group. But expression level of this gene in each group was showed high variability. İn this study, we have determined that NMDA receptor coding gene GRIN2B expression level was down regulated in AD patients when compared with healthy control individuals. According to our results, we have speculated that GRIN2B expression level was associated with AD. But it is necessary to validate these results with bigger sample size.
162
37565
SOCS1 Inhibits MDR1 in Mammary Cell Carcinoma Reverses Multidrug Resistance
Abstract:
Suppressors of cytokine signalling (SOCS1), a newly indentified antiapoptotic molecule is a downstream effector of the receptor tyrosine kinase-Ras signalling pathway. The current study has uncovered that SOCS1 may have wide and imperative capacities, particularly because of its close correlation with malignant tumors. To investigate the impact of SOCS1 on MDR, we analyzed the expression of P-gp and SOCS1 by immunohistochemistry and found there was a positive correlation between them. At that point, we effectively interfered with RNA translation by the contamination of siRNA of SOCS1 into MCF7/ADM breast cancer cell lines through a lentivirus, and the expression of the target gene was significantly inhibited. After RNAi, the drug resistance was reduced altogether and the expression of MDR1 mRNA and P-gp in MCF7/ADM cell lines demonstrated a significant decrease. Likewise, the expression of P53 protein increased in a statistically significant manner (p ≤ 0.01) after RNAi exposure. Moreover, flow cytometry analysis uncovers that cell cycle and anti-apoptotic enhancing capacity of cells changed after RNAi treatment. These outcomes proposed SOCS1 may take part in breast cancer MDR by managing MDR1 and P53 expression, changing cell cycle and enhancing the anti-apoptotic ability.
161
54940
Oncogenic Functions of Long Non-Coding RNA XIST in Human Nasopharyngeal Carcinoma by Targeting MiR-34a-5p
Abstract:
Long non-coding RNA (lncRNA) X inactivate-specific transcript (XIST) has been verified as an oncogenic gene in several human malignant tumors, and its dysregulation was closed associated with tumor initiation, development and progression. Nevertheless, whether the aberrant expression of XIST in human nasopharyngeal carcinoma (NPC) is corrected with malignancy, metastasis or prognosis has not been elaborated. Here, we discovered that XIST was up-regulated in NPC tissues and higher expression of XIST contributed to a markedly poorer survival time. In addition, multivariate analysis demonstrated XIST was an independent risk factor for prognosis. XIST over-expression enhanced, while XIST silencing hampered the cell growth in NPC. Additionally, mechanistic analysis revealed that XIST up-regulated the expression of miR-34a-5p targeted gene E2F3 through acting as a competitive ‘sponge’ of miR-34a-5p. Taking all into account, we concluded that XIST functioned as an oncogene in NPC through up-regulating E2F3 in part through ‘spongeing’ miR-34a-5p.
160
94082
Gene Expression and Staining Agents: Exploring the Factors That Influence the Electrophoretic Properties of Fluorescent Proteins
Abstract:
Fluorescent proteins are self-sufficient in forming chromophores with a visible wavelength from 3 amino acids sequence within their own polypeptide structure. This chromophore – a molecule that absorbs a photon of light and exhibits an energy transition equal to the energy of the absorbed photon. Fluorescent proteins (FPs) consisted of a chain of 238 amino acid residues and composed of 11 beta strands shaped in a cylinder surrounding an alpha helix structure. A better understanding of the system of the chromospheres and the increasing advance in protein engineering in recent years, the properties of FPs offers the potential for new applications. They have used sensors and probes in molecular biology and cell-based research that giving a chance to observe these FPs tagged cell localization, structural variation and movement. For clarifying functional uses of fluorescent proteins, electrophoretic properties of these proteins are one of the most important parameters. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) analysis is used for determining electrophoretic properties commonly. While there are many techniques are used for determining the functionality of protein-based research, SDS-PAGE analysis can only provide a molecular level assessment of the proteolytic fragments. Before SDS-PAGE analysis, fluorescent proteins need to successfully purified. Due to directly purification of the target, FPs is difficult from the animal, gene expression is commonly used which must be done by transformation with the plasmid. Furthermore, used gel within electrophoresis and staining agents properties have a key role. In this review, the different factors that have the impact on the electrophoretic properties of fluorescent proteins explored. Fluorescent protein separation and purification are the essential steps before electrophoresis that should be done very carefully. For protein purification, gene expression process and following steps have a significant function. For successful gene expression, the properties of selected bacteria for expression, used plasmid are essential. Each bacteria has own characteristics which are very sensitive to gene expression, also used procedure is the important factor for fluorescent protein expression. Another important factors are gel formula and used staining agents. Gel formula has an effect on the specific proteins mobilization and staining with correct agents is a key step for visualization of electrophoretic bands of protein. Visuality of proteins can be changed depending on staining reagents. Apparently, this review has emphasized that gene expression and purification have a stronger effect than electrophoresis protocol and staining agents.
159
88188
Predicting Dose Level and Length of Time for Radiation Exposure Using Gene Expression
Abstract:
In a large-scale radiologic emergency, potentially affected population need to be triaged efficiently using various biomarkers where personal dosimeters are not likely worn by the individuals. It has long been established that radiation injury can be estimated effectively using panels of genetic biomarkers. Furthermore, the rate of radiation, in addition to dose of radiation, plays a major role in determining biological responses. Therefore, a better and more accurate triage involves estimating both the dose level of the exposure and the length of time of that exposure. To that end, a large in vivo study was carried out on mice with internal emitter caesium-137 (¹³⁷Cs). Four different injection doses of ¹³⁷Cs were used: 157.5 μCi, 191 μCi, 214.5μCi, and 259 μCi. Cohorts of 6~7 mice from the control arm and each of the dose levels were sacrificed, and blood was collected 2, 3, 5, 7 and 14 days after injection for microarray RNA gene expression analysis. Using a generalized linear model with penalized maximum likelihood, a panel of 244 genes was established and both the doses of injection and the number of days after injection were accurately predicted for all 155 subjects using this panel. This has proven that microarray gene expression can be used effectively in radiation biodosimetry in predicting both the dose levels and the length of exposure time, which provides a more holistic view on radiation exposure and helps improving radiation damage assessment and treatment.
158
41304
The Effects of Highly Active Antiretroviral Therapy (HAART) on the Expression of Muc1 and P65 in a Cervical Cancer Cell Line, HCS-2
Abstract:
Cervical cancer is the third most commonly diagnosed cancer globally and it is one of three AIDS defining malignancies. Highly active antiretroviral therapy (HAART) is a combination of three or more antiretroviral drugs and has been shown to play a significant role in reducing the incidence of some AIDS defining malignancies, although its effect on cervical cancer is still unclear. The aim of this study was to investigate the relationship between cervical cancer and HAART. This was achieved by studying the expression of two signalling molecules expressed in cervical cancer; MUC1 and P65. Following the 24 hour treatment of a cervical cancer cell line, HCS-2, with drugs which are commonly used as part of HAART at their clinical plasma concentrations, real-time qPCR and immunofluorescence were used in order to study gene and protein expression. A one way ANOVA followed by a Tukey Kramer Post Hoc test was conducted using JMP 11 software on both sets of data. The drug classified as a protease inhibitor (PI) (i.e. LPV/r) reduced MUC1 and P65 gene and protein expression more than the other drug tested. PIs are known to play a significant role in cell death, therefore the cells were thought to be more susceptible to cell death following treatment with PIs. In conclusion, the drugs used, especially the PI showed some anticancer effects by facilitating cell death through decreased gene and protein expression of MUC1 and P65 and present promising agents for cancer treatment.
157
19029
GABARAPL1 (GEC1) mRNA Expression Levels in Patients with Alzheimer's Disease
Abstract:
The GABARAP (GABAA-receptor-associated protein) family consists of GABARAP, GABARAPL1 (GABARAP-like 1) and GABARAPL2 (GABARAP-like 2). GABARAPL1, like GABARAP, was described to interact with both GABAA receptor and tubulin, and to be involved in intracellular GABAA receptor trafficking and promoting tubulin polymerization. In addition, GABARAPL1 is thought to be involved in various physiological (autophagosome closure, regulation of circadian rhythms) and/or pathological mechanisms (cancer, neurodegeneration). Alzheimer’s disease (AD) is a progressive neuro degenerative disorder characterized with impaired cognitive functions. Disruption of the GABAergic neuro transmission as well as cholinergic and glutamatergic interactions, may also be involved in the pathogenesis of AD. GABARAPL1 presents a regulated tissue expression and is the most expressed gene among the GABARAP family members in the central nervous system. We, herein, conducted a study to investigate the GABARAPL1 mRNA expression levels in patients with AD. 50 patients with AD and 49 control patients were enrolled to the present study. Messenger RNA expression levels of GABARAPL1 were detected by real-time polymerase chain reaction. GABARAPL1 mRNA expression in AD / control patients was 0,495 (95% confidence interval: 0,404-0,607), p= 0,00000002646. Reduced activity of GABARAPL1 gene might play a role, at least partly, in the pathophysiology of AD.
156
85954
Evaluation of Gene Expression after in Vitro Differentiation of Human Bone Marrow-Derived Stem Cells to Insulin-Producing Cells
Abstract:
Many protocols were publicized for differentiation of human mesenchymal stem cells (MSCS) into insulin-producing cells (IPCs) in order to excrete insulin hormone ingoing to treat diabetes disease. Our aim is to evaluate relative gene expression for each independent protocol. Human bone marrow cells were derived from three volunteers that suffer diabetes disease. After expansion of mesenchymal stem cells, differentiation of these cells was done by three different protocols (the one-step protocol was used conophylline protein, the two steps protocol was depending on trichostatin-A, and the three-step protocol was started by beta-mercaptoethanol). Evaluation of gene expression was carried out by real-time PCR: Pancreatic endocrine genes, transcription factors, glucose transporter, precursor markers, pancreatic enzymes, proteolytic cleavage, extracellular matrix and cell surface protein. Quantitation of insulin secretion was detected by immunofluorescence technique in 24-well plate. Most of the genes studied were up-regulated in the in vitro differentiated cells, and also insulin production was observed in the three independent protocols. There were some slight increases in expression of endocrine mRNA of two-step protocol and its insulin production. So, the two-step protocol was showed a more efficient in expressing of pancreatic endocrine genes and its insulin production than the other two protocols.
155
62825
Cas9-Assisted Direct Cloning and Refactoring of a Silent Biosynthetic Gene Cluster
Authors:
Abstract:
Natural products produced from marine bacteria serve as an immense reservoir for anti-infective drugs and therapeutic agents. Nowadays, heterologous expression of gene clusters of interests has been widely adopted as an effective strategy for natural product discovery. Briefly, the heterologous expression flowchart would be: biosynthetic gene cluster identification, pathway construction and expression, and product detection. However, gene cluster capture using traditional Transformation-associated recombination (TAR) protocol is low-efficient (0.5% positive colony rate). To make things worse, most of these putative new natural products are only predicted by bioinformatics analysis such as antiSMASH, and their corresponding natural products biosynthetic pathways are either not expressed or expressed at very low levels under laboratory conditions. Those setbacks have inspired us to focus on seeking new technologies to efficiently edit and refractor of biosynthetic gene clusters. Recently, two cutting-edge techniques have attracted our attention - the CRISPR-Cas9 and Gibson Assembly. By now, we have tried to pretreat Brevibacillus laterosporus strain genomic DNA with CRISPR-Cas9 nucleases that specifically generated breaks near the gene cluster of interest. This trial resulted in an increase in the efficiency of gene cluster capture (9%). Moreover, using Gibson Assembly by adding/deleting certain operon and tailoring enzymes regardless of end compatibility, the silent construct (~80kb) has been successfully refactored into an active one, yielded a series of analogs expected. With the appearances of the novel molecular tools, we are confident to believe that development of a high throughput mature pipeline for DNA assembly, transformation, product isolation and identification would no longer be a daydream for marine natural product discovery.
154
10059
The Biocompatibility and Osteogenic Potential of Experimental Calcium Silicate Based Root Canal Sealer, Capseal
Abstract:
Aim: Capseal I and Capseal II are calcium silicate and calcium phosphate based experimental root canal sealer. The aim of this study was to evaluate the biocompatibility and mineralization potential of Capseal I and Capseal II. Materials and Methods: The biocompatibility and mineralization-related gene expression (alkaline phosphatase (ALP), bone sialoprotein (BSP), and osteocalcin (OCN)) of Capseal I and Capseal II were compared using methylthiazol tetrazolium assay and reverse transcription-polymerization chain reaction analysis, respectively. The results were analyzed by Kruskal-Wallis test. P-value of < 0.05 was considered significant. Result: Both Capseal I and Capseal II were favorable in biocompatibility and influenced the messenger RNA expression of ALP and BSP. Conclusion: Within the limitation of this study, Capseal is biocompatible and have mineralization promoting potential, and thus could be a promising root canal sealer.
153
56824
Effects of Exercise on Klotho Expression and Klotho DNA Methylation in Obese Mice
Abstract:
The Klotho gene has been found to be involved in cardiovascular health, and epigenetic mechanism has risen as good candidates to understand the role of lifestyle factors in obesity. The aim of this study was to investigate the effect of exercise intervention on the expression and DNA methylation of Klotho gene in high-fat diet induced obese mice. C57BL/6 male mice were fed a normal diet (ND) or a high-fat diet (HFD) for 12 weeks. HFD induced obese mice were divided into secondary group (SED) and exercise group (EX) randomly. The treadmill exercise was performed in EX group for 8 weeks. The expression and DNA methylation of Klotho were evaluated by Western blot, RT-PCR, and Methylation-specific PCR. Results indicated that Klotho protein and mRNA expression were significantly lower in the SED group than those in the ND and EX groups (P< 0.01), whereas no significant difference, was found between ND group and EX group (P>0.05). Furthermore, mice in the ND group and SED group showed significantly lower levels of completely methylated Klotho DNA in ND group (0%) and SED group (50%) compared with the EX group (90%), and unmethylated Klotho DNA level in ND group (80%) was significantly higher than those in the SED (0%) and EX (0%) groups. These results suggested that exercise leads to increased Klotho expression and reduced Klotho DNA methylation level in HFD induced obese mice.
152
2425
Functional Expression and Characterization of a Novel Indigenous Endo-Beta 1,4- Glucanase from Apis mellifera
Abstract:
Apis mellifera is an insect of immense economic importance lives on rich carbohydrate diet including cellulose, nectar, honey and pollen. The carbohydrate metabolism in A mellifera has not been understood fully, as there are no data available, on the functional expression of cellulase gene. The cellulose hydrolyzing enzyme is required for the digestion of pollen cellulose wall, to release the important nutrients (amino acids, minerals, vitamins etc.) from the pollen. A dissection of Apis genome had revealed that there is one gene present for the expression of endo-beta-1,4-glucanase, for cellulose hydrolysis. In the presented work, functional expression of endo-beta-1,4 glucanase gene is reported. Total soluble proteins of the honey bee were isolated and were tested cellulose hydrolyzing enzyme activity, using carboxy-methyl cellulose, as a substrate. A mellifera proteins were able to hydrolyze carboxy-methyl cellulose, confirming its endo- type mode of action. Endo beta-1,4 glucanase enzyme was only present in the gut tissues, no activity was detected in the salivary glands. The pH optima of the enzyme were in the acidic pH range of 4-5-5-0, indicating its metabolic role in the acidic stomach of A mellifera. The reported enzyme is unique, as endo-beta- 1,4 glucanase was able to generate non reducing sugar, as an end product. The results presented, are supportive to the information that the honey bee is capable of producing its novel endo-beta-1,4 glucanase. Further it could be helpful, in understanding, the carbohydrate metabolism in A mellifera.
151
20198
Microarray Data Visualization and Preprocessing Using R and Bioconductor
Abstract:
Microarrays provide a rich source of data on the molecular working of cells. Each microarray reports on the abundance of tens of thousands of mRNAs. Virtually every human disease is being studied using microarrays with the hope of finding the molecular mechanisms of disease. Bioinformatics analysis plays an important part of processing the information embedded in large-scale expression profiling studies and for laying the foundation for biological interpretation. A basic, yet challenging task in the analysis of microarray gene expression data is the identification of changes in gene expression that are associated with particular biological conditions. Careful statistical design and analysis are essential to improve the efficiency and reliability of microarray experiments throughout the data acquisition and analysis process. One of the most popular platforms for microarray analysis is Bioconductor, an open source and open development software project based on the R programming language. This paper describes specific procedures for conducting quality assessment, visualization and preprocessing of Affymetrix Gene Chip and also details the different bioconductor packages used to analyze affymetrix microarray data and describe the analysis and outcome of each plots.
150
25521
Correlation between Polysaccharides Molecular Weight Changes and Pectinases Gene Expression during Papaya Ripening
Abstract:
Fruit softening is the main change that occurs during papaya (Carica papaya L.) ripening. It is characterized by the depolymerization of cell wall polysaccharides, especially the pectic fractions, which causes cell wall disassembling. However, it is uncertain how the modification of the two main pectin polysaccharides fractions (water-soluble – WSF, and oxalate-soluble fractions - OSF) accounts for fruit softening. The aim of this work was to correlate molecular weight changes of WSF and OSF with the gene expression of pectin-solubilizing enzymes (pectinases) during papaya ripening. Papaya fruits obtained from a producer were harvest and storage under specific conditions. The fruits were divided in five groups according to days after harvesting. Cell walls from all groups of papaya pulp were isolated and fractionated (WSF and OSF). Expression profiles of pectinase genes were achieved according to the MIQE guidelines (Minimum Information for publication of Quantitative real-time PCR Experiments). The results showed an increased yield and a decreased molecular weight throughout ripening for WSF and OSF. Gene expression data support that papaya softening is achieved by polygalacturonases (PGs) up-regulation, in which their actions might have been facilitated by the constant action of pectinesterases (PMEs). Moreover, BGAL1 gene was up-regulated during ripening with a simultaneous galactose release, suggesting that galactosidases (GALs) could also account for pulp softening. The data suggest that a solubilization of galacturonans and a depolymerization of cell wall components were caused mainly by the action of PGs and GALs.
149
94889
Transcriptomic Analysis of Acanthamoeba castellanii Virulence Alteration by Epigenetic DNA Methylation
Abstract:
Background: Acanthamoeba is a genus of amoebae which lives as a free-living in nature or as a human pathogen that causes severe brain and eye infections. Virulence potential of Acanthamoeba is not constant and can change with growth conditions. DNA methylation, an epigenetic process which adds methyl groups to DNA, is used by eukaryotic cells, including several human parasites to control their gene expression. We used qPCR, siRNA gene silencing, and RNA sequencing (RNA-Seq) to study DNA-methyltransferase gene family (DNMT) in order to indicate the possibility of its involvement in programming Acanthamoeba virulence potential. Methods: A virulence-attenuated Acanthamoeba isolate (designation: ATCC; original isolate: ATCC 50492) was subjected to mouse passages to restore its pathogenicity; a virulence-reactivated isolate (designation: AC/5) was generated. Several established factors associated with Acanthamoeba virulence phenotype were examined to confirm the succession of reactivation process. Differential gene expression of DNMT between ATCC and AC/5 isolates was performed by qPCR. Silencing on DNMT gene expression in AC/5 isolate was achieved by siRNA duplex. Total RNAs extracted from ATCC, AC/5, and siRNA-treated (designation: si-146) were subjected to RNA-Seq for comparative transcriptomic analysis in order to identify the genome-wide effect of DNMT in regulating Acanthamoeba gene expression. qPCR was performed to validate the RNA-Seq results. Results: Physiological and cytophatic assays demonstrated an increased in virulence potential of AC/5 isolate after mouse passages. DNMT gene expression was significantly higher in AC/5 compared to ATCC isolate (p ≤ 0.01) by qPCR. si-146 duplex reduced DNMT gene expression in AC/5 isolate by 30%. Comparative transcriptome analysis identified the differentially expressed genes, with 3768 genes in AC/5 vs ATCC isolate; 2102 genes in si-146 vs AC/5 isolate and 3422 genes in si-146 vs ATCC isolate, respectively (fold-change of ≥ 2 or ≤ 0.5, p-value adjusted (padj) < 0.05). Of these, 840 and 1262 genes were upregulated and downregulated, respectively, in si-146 vs AC/5 isolate. Eukaryotic orthologous group (KOG) assignments revealed a higher percentage of downregulated gene expression in si-146 compared to AC/5 isolate, were related to posttranslational modification, signal transduction and energy production. Gene Ontology (GO) terms for those downregulated genes shown were associated with transport activity, oxidation-reduction process, and metabolic process. Among these downregulated genes were putative genes encoded for heat shock proteins, transporters, ubiquitin-related proteins, proteins for vesicular trafficking (small GTPases), and oxidoreductases. Functional analysis of similar predicted proteins had been described in other parasitic protozoa for their survival and pathogenicity. Decreased expression of these genes in si146-treated isolate may account in part for Acanthamoeba reduced pathogenicity. qPCR on 6 selected genes upregulated in AC/5 compared to ATCC isolate corroborated the RNA sequencing findings, indicating a good concordance between these two analyses. Conclusion: To the best of our knowledge, this study represents the first genome-wide analysis of DNA methylation and its effects on gene expression in Acanthamoeba spp. The present data indicate that DNA methylation has substantial effect on global gene expression, allowing further dissection of the genome-wide effects of DNA-methyltransferase gene in regulating Acanthamoeba pathogenicity.
148
49549
Application of Gene Expression Programming (GEP) in Predicting Uniaxial Compressive Strength of Pyroclastic Rocks
Abstract:
The uniaxial compressive strength (UCS) of rocks is an important input parameter for the design of rock engineering project. Compressive strength can be determined in the laboratory using the uniaxial compressive strength (UCS) test. Although the test is relatively simple, the method is time consuming and expensive. Therefore many researchers have tried to assess the uniaxial compressive strength values of rocks via relatively simple and indirect tests (e.g. point load strength test, Schmidt Hammer hardness rebound test, P-wave velocity test, etc.). Pyroclastic rocks are widely exposed in the various regions of the world. Cappadocia region located in the Central Anatolia is one of the most spectacular cite of these regions. It is important to determine the mechanical behaviour of the pyroclastic rocks due to their ease of carving, heat insulation properties and building some civil engineering constructions in them. The purpose of this study is to estimate a widely varying uniaxial strength of pyroclastic rocks from Cappadocia region by means of point load strength, porosity, dry density and saturated density tests utilizing gene expression programming.
147
24073
Drought Alters the Expression of a Candidate Zea Mays P-Coumarate 3-Hydroxylase Gene and Caffeic Acid Biosynthesis
Abstract:
The enzymatic activity of p-coumarate 3-hydroxylase (C3H) synthesize caffeic acid from p-coumaric acid. We recently showed that exogenously applied caffeic acid confers salinity tolerance in soybean (Glycine max) by inducing antioxidant enzymatic activity to promote enhanced scavenging or reactive oxygen species, thus limiting salinity-induced oxidative stress. Recent evidence also establishes that pre-treatment of plants with exogenously supplied caffeic acid improves plant tolerance to osmotic stress by improving plant antioxidant capacity and enhancing biosynthesis of compatible solutes. We aimed to identify a C3H in maize (Zea mays) and evaluate the effect of drought on the spatial and temporal expression of the gene encoding the candidate maize C3H (ZmC3H). Primary sequence analysis shows that ZmC3H shares 71% identity with an Arabidopsis thaliana C3H that is implicated in the control of Arabidopsis cell expansion, growth, and responses to stress. In silico ZmC3H promoter analysis reveals the presence of cis-acting elements that interact with transcription factors implicated in plant responses to drought. Spatial expression analysis by semi-quantitative RT-PCR shows that ZmC3H is expressed in both leaves and roots under normal conditions. However, drought represses the expression of ZmC3H in leaves whereas it up-regulates its expression in roots. These changes in ZmC3H expression correlate with the changes in the content of caffeic acid in maize in response to drought. We illustrate the implications of these changes in the expression of the gene in relation to maize responses to drought and discuss the potential of regulating caffeic acid biosynthesis towards genetic improvement of maize tolerance to drought stress. These findings have implications for food security because of the potential of the implications of the study for drought tolerance in maize.
146
24320
Identification of a Novel Maize Dehydration-Responsive Gene with a Potential Role in Improving Maize Drought Tolerance
Abstract:
Global climate change has resulted in altered rainfall patterns, which has resulted in annual losses in maize crop yields due to drought. Therefore it is important to produce maize cultivars that are more drought-tolerant, which is not an easily accomplished task as plants have a plethora of physical and biochemical adaptation methods. One such mechanism is the drought-induced expression of enzymatic and non-enzymatic proteins which assist plants to resist the effects of drought on their growth and development. One of these proteins is AtRD22 which has been identified in Arabidopsis thaliana. Using an in silico approach, a maize protein with 48% sequence homology to AtRD22 has been identified. This protein appears to be localized in the extracellular matrix, similarly to AtRD22. Promoter analysis of the encoding gene reveals cis-acting elements suggestive of induction of the gene’s expression by abscisic acid (ABA). Semi-quantitative transcriptomic analysis of the putative maize RD22 has revealed an increase in transcript levels after the exposure to drought. Current work elucidates the effect of up-regulation and silencing of the maize RD22 gene on the tolerance of maize to drought. The potential role of the maize RD22 gene in maize drought tolerance can be used as a tool to improve food security.
145
17266
Detection of Transgenes in Cotton (Gossypium hirsutum L.) by using Biotechnology/Molecular Biological Techniques
Abstract:
Agriculture is the backbone of economy of Pakistan and Cotton is the major agricultural export and supreme source of raw fiber for our textile industry. To combat against the developing resistance in the target insects and combating these challenges wholesomely, a novel combination of pyramided/stacked genes was conceptualized and later realized, through the means of biotechnology i.e., transformation of three genes namely, Cry1Ac, Cry2A, and EPSP synthase (glyphosate tolerant) genes in the locally cultivated cotton variety. The progenies of the transformed plants were successfully raised and screened under the tunnel conditions for two generations and the present study focused on the screening of plants which were confirmed for containing all of these three genes and their expressions. Initially, the screening was done through glyphosate spray assay and the plants which were healthy and showed no damage on leaves were selected after 07 days of spray. In the laboratory, the DNA of these plants were isolated and subjected to amplification of the three genes. Thus, seventeen out of twenty were confirmed positive for Cry1Ac gene and ten out of twenty were positive for Cry2A gene and all twenty were positive for presence of EPSP synthase gene. Then, the ten plant samples which were confirmed with presence of all three genes were subjected to expression analysis of these proteins through ELISA. The results showed that eight out of ten plants were actively expressing the three transgenes. Real-time PCR was also done to quantify the expression levels of the EPSP synthase gene. Finally, eight plants were confirmed for the presence and active expression of all three genes in T3 generation of the triple gene transformed cotton. These plants may be subjected to T4 generation to develop a new stable variety in due course of time.
144
98537
Impact of Ocean Acidification on Gene Expression Dynamics during Development of the Sea Urchin Species Heliocidaris erythrogramma
Abstract:
Marine invertebrate species with calcifying larvae are especially vulnerable to ocean acidification (OA) caused by rising atmospheric CO₂ levels. Acidic conditions can delay development, suppress metabolism, and decrease the availability of carbonate ions in the ocean environment for skeletogenesis. These stresses often result in increased larval mortality, which may lead to significant ecological consequences including alterations to the larval settlement, population distribution, and genetic connectivity. Importantly, many of these physiological and developmental effects are caused by genetic and molecular level changes. Although many studies have examined the effect of near-future oceanic pH levels on gene expression in marine invertebrates, little is known about the impact of OA on gene expression in a developmental context. Here, we performed mRNA-sequencing to investigate the impact of environmental acidity on gene expression across three developmental stages in the sea urchin Heliocidaris erythrogramma. We collected RNA from gastrula, early larva, and 1-day post-metamorphic juvenile sea urchins cultured at present-day and predicted future oceanic pH levels (pH 8.1 and 7.7, respectively). We assembled an annotated reference transcriptome encompassing development from egg to ten days post-metamorphosis by combining these data with datasets from two previous developmental transcriptomic studies of H. erythrogramma. Differential gene expression and time course analyses between pH conditions revealed significant alterations to developmental transcription that are potentially associated with pH stress. Consistent with previous investigations, genes involved in biomineralization and ion transport were significantly upregulated under acidic conditions. Differences in gene expression between the two pH conditions became more pronounced post-metamorphosis, suggesting a development-dependent effect of OA on gene expression. Furthermore, many differences in gene expression later in development appeared to be a result of broad downregulation at pH 7.7: of 539 genes differentially expressed at the juvenile stage, 519 of these were lower in the acidic condition. Time course comparisons between pH 8.1 and 7.7 samples also demonstrated over 500 genes were more lowly expressed in pH 7.7 samples throughout development. Of the genes exhibiting stage-dependent expression level changes, over 15% of these diverged from the expected temporal pattern of expression in the acidic condition. Through these analyses, we identify novel candidate genes involved in development, metabolism, and transcriptional regulation that are possibly affected by pH stress. Our results demonstrate that pH stress significantly alters gene expression dynamics throughout development. A large number of genes differentially expressed between pH conditions in juveniles relative to earlier stages may be attributed to the effects of acidity on transcriptional regulation, as a greater proportion of mRNA at this later stage has been nascent transcribed rather than maternally loaded. Also, the overall downregulation of many genes in the acidic condition suggests that OA-induced developmental delay manifests as suppressed mRNA expression, possibly from lower transcription rates or increased mRNA degradation in the acidic environment. Further studies will be necessary to determine in greater detail the extent of OA effects on early developing marine invertebrates.
143
19034
Identification of Hepatocellular Carcinoma Using Supervised Learning Algorithms
Authors:
Abstract:
Analysis of diseases integrating multi-factors increases the complexity of the problem and therefore, development of frameworks for the analysis of diseases is an issue that is currently a topic of intense research. Due to the inter-dependence of the various parameters, the use of traditional methodologies has not been very effective. Consequently, newer methodologies are being sought to deal with the problem. Supervised Learning Algorithms are commonly used for performing the prediction on previously unseen data. These algorithms are commonly used for applications in fields ranging from image analysis to protein structure and function prediction and they get trained using a known dataset to come up with a predictor model that generates reasonable predictions for the response to new data. Gene expression profiles generated by DNA analysis experiments can be quite complex since these experiments can involve hypotheses involving entire genomes. The application of well-known machine learning algorithm - Support Vector Machine - to analyze the expression levels of thousands of genes simultaneously in a timely, automated and cost effective way is thus used. The objectives to undertake the presented work are development of a methodology to identify genes relevant to Hepatocellular Carcinoma (HCC) from gene expression dataset utilizing supervised learning algorithms and statistical evaluations along with development of a predictive framework that can perform classification tasks on new, unseen data.
142
43474
SOCS3 Reverses Multidrug Resistance by Inhibiting MDR1 in Mammary Cell Carcinoma
Abstract:
Suppressors of cytokine signalling (SOCS3), a newly indentified anti-apoptotic molecule is a downstream effecter of the receptor tyrosine kinase-Ras signalling pathway. Current study has uncovered that SOCS3 may have wide and imperative capacities, particularly because of its close correlation with malignant tumors. To investigate the impact of SOCS3 on MDR, we analyzed the expression of P-gp and SOCS3 by immune-histochemistry and found there was positive correlation between them. At that point we effectively interfered with RNA translation by the contamination of siRNA of SOCS3 into MCF7/ADM breast cancer cell lines through a lentivirus, and the expression of the target gene was significantly inhibited. After RNAi the drug resistance was reduced altogether and the expression of MDR1 mRNA and P-gp in MCF7/ADM cell lines demonstrated a significant decrease. Likewise the expression of P53 protein increased in a statistically significant manner (p ≤ 0.01) after RNAi exposure. Moreover, flowcytometry analysis uncovers that cell cycle and anti-apoptotic enhancing capacity of cells changed after RNAi treatment. These outcomes proposed SOCS3 may take part in breast cancer MDR by managing MDR1 and P53 expression, changing cell cycle and enhancing the anti-apoptotic ability.
141
45408
Intracellular Strategies for Gene Delivery into Mammalian Cells Using Bacteria as a Vector
Abstract:
E. coli has been engineered by our group and by others as a vector to deliver DNA into cultured human and animal cells. However, so far conditions to improve gene delivery using this vector have not been investigated, resulting in a major gap in our understanding of the requirements for this vector to function optimally. Our group recently published novel data showing that simple addition of the DNA transfection reagent Lipofectamine increased the efficiency of the E. coli vector by almost 3-fold, providing the first strong evidence that further optimization of bactofection is possible. This presentation will discuss advances that demonstrate the effects of several intracellular strategies that improve the efficiency of this vector. Conditions that promote endosomal escape of internalized bacteria to evade lysosomal destruction after entry in the cell, a known obstacle limiting this vector, are elucidated. Further, treatments that increase bacterial lysis so that the vector can release its transgene into the mammalian environment for expression will be discussed. These experiments will provide valuable new insight to advance this E. coli system as an important class of vector technology for genetic correction of human disease models in cells and whole animals.
140
25818
Microarray Gene Expression Data Dimensionality Reduction Using PCA
Abstract:
Different experimental technologies such as microarray sequencing have been proposed to generate high-resolution genetic data, in order to understand the complex dynamic interactions between complex diseases and the biological system components of genes and gene products. However, the generated samples have a very large dimension reaching thousands. Therefore, hindering all attempts to design a classifier system that can identify diseases based on such data. Additionally, the high overlap in the class distributions makes the task more difficult. The data we experiment with is generated for the identification of autism. It includes 142 samples, which is small compared to the large dimension of the data. The classifier systems trained on this data yield very low classification rates that are almost equivalent to a guess. We aim at reducing the data dimension and improve it for classification. Here, we experiment with applying a multistage PCA on the genetic data to reduce its dimensionality. Results show a significant improvement in the classification rates which increases the possibility of building an automated system for autism detection.
139
59150
Chemical Synthesis of a cDNA and Its Expression Analysis
Abstract:
Synthetic cDNA (ScDNA) of granulocyte colony-stimulating factor (G-CSF) was constructed using a DNA synthesizer with the aim to increase its expression level. 5' end of the ScDNA of G-CSF coding region was modified by decreasing the GC content without altering the predicted amino acids sequence. The identity of the resulting protein from ScDNA was confirmed by the highly specific enzyme-linked immunosorbent assay. In conclusion, a synthetic G-CSF cDNA in combination with the recombinant DNA protocol offers a rapid and reliable strategy for synthesizing the target protein. However, the commercial utilization of this methodology requires rigorous validation and quality control.
138
10174
Innate Immune Expression in Heterophils in Response to LPS
Abstract:
Although chicken strains show differences in susceptibility to a number of diseases, the underlying immunological basis is yet to be elucidated. In the present study, heterophils were subjected to LPS stimulation and total RNA extraction, further differential gene expression was studied in broiler, layer and indigenous Aseel strain by Real Time RT-PCR at different time periods before and after induction. The expression of the 14 AvBDs and chTLR 1, 2, 3, 4, 5, 7, 15 and 21 was detectable in heterophils. The expression level of most of the AvBDs significantly increased (P< 0.05) 3 hours post in vitro lipopolysaccharide challenge. Higher expression level and stronger activation of most AvBDs, NFkB-1 and IRF-3 in heterophils was observed with the stimulation of LPS in layer compared to broiler, and in Aseel compared to both layer and broiler. This investigation will allow more refined interpretation of immuno-genetic basis of the variable disease resistance/susceptibility in divergent stock of chicken including indigenous breed. Moreover, this study will be helpful in formulation of strategy for isolation of antimicrobial peptides from heterophils.
137
39574
ICAM1 Expression is Enhanced by TNFa through Histone Methylation in Human Brain Microvessel Cells
Abstract:
Intracellular adhesion molecule1 (ICAM1) is a mediator of inflammation and involved in adhesion and transmigration of leukocytes to endothelial cells, resulting in enhancement of brain inflammation. We hypothesized that increase of ICAM1 expression in endothelial cells is an early step in the pathogenesis of brain diseases such as Alzheimer’s disease. Here, we report that ICAM1 expression is regulated by pro-inflammatory cytokine TNFa in human microvascular endothelial cell (HBMVEC). TNFa significantly increased ICAM1 mRNA and protein levels at the concentrations showing no cell toxicity. This increase was also shown in micro vessels of mouse brain 24 hours after treatment with TNFa (8 mg/kg, i.v). We then investigated the epigenetic mechanism involved in the induction of ICAM1 expression. Chromatin immunoprecipitation assay revealed that TNFa reduced methylation of histone3K9 (H3K9-2me) and histone3K27 (H3K27-3me), well-known modification as gene suppression, with in the ICAM1 promoter region. However, acetylation of H3K9 and H3K14, well-known modification as gene activation, was not changed by TNFa. Treatment of BIX01294, a specific inhibitor of histone methyltransferase G9a responsible for H3K9-2me, dramatically increased in ICAM1 mRNA and protein levels and overexpression of G9a gene suppressed TNFa-induced ICAM1 expression. In contrast, GSK126, an inhibitor of histone methyltransferase EZH2 responsible for H3K27-3me and valproic acid, an inhibitor of histone deacetylase (HDAC) did not affect ICAM1 expression. These results suggested that histone3 methylation is involved in ICAM1 repression. Moreover, TNFa or BIX01294-induced ICAM induction resulted in both enhancements in adhesion and transmigration of leukocyte on endothelial cell. This study demonstrates that TNFa upregulates ICAM1 expression through H3K9-2me and H3K27-3me within the ICAM1 promoter region, in which G9a is likely to play a pivotal role in ICAM1 transcription. Our study provides a novel mechanism for ICAM1 transcription regulation in HBMVEC.
136
78709
Molecular Characterization of Major Isolated Organism Involved in Bovine Subclinical Mastitis
Authors:
Abstract:
Mastitis is a common problem of dairy industries. Reduction in milk production and an irreparable damage to the udder associated with the disease are common causes of culling of dairy cows. Milk from infected animals is not suitable for drinking and for making different milk products. So, it has a major economic importance in dairy cattle. The aims of this study were to investigate the bacteriological panorama in milk from udder quarters with subclinical mastitis and to carried out for the molecular characterization of the major isolated organisms, from subclinical mastitis-affected cows in and around Durg and Rajnandgaon district of Chhattisgarh. Isolation and identification of bacteria from the milk samples of subclinical mastitis-affected cows were done by standard and routine culture procedures. A total of 78 isolates were obtained from cows and among the various bacteria isolated, Staphylococcus spp. occupied prime position with occurrence rate of 51.282%. However, other bacteria isolated includeStreptococcus spp. (20.512%), Micrococcus spp. (14.102%), E. coli (8.974%), Klebsiela spp. (2.564%), Salmonella spp. (1.282%) and Proteus spp. (1.282%). Staphylococcus spp. was isolated as the major causative agent of subclinical mastitis in the studied area. Molecular characterization of Staphylococus aureusisolates was done for genetic expression of the virulence genes like ‘nuc’ encoding thermonucleaseexoenzyme, coa and spa by PCR amplification of the respective genes in 25 Staphylococcus isolates. In the present study, 15 isolates (77.27%) out of 20 coagulase positive isolates were found to be genotypically positive for ‘nuc’ where as 20 isolates (52.63%) out of 38 CNS expressed the presence of the same virulence gene. In the present study, three Staphylococcus isolates were found to be genotypically positive for coa gene. The Amplification of the coa gene yielded two different products of 627, 710 bp. The amplification of the gene segment encoding the IgG binding region of protein A (spa) revealed a size of 220 and 253bp in twostaphylococcus isolates. The X-region binding of the spa gene produced an amplicon of 315 bp in one Staphylococcal isolates. Staphylococcus aureus was found to be major isolate (51.28%) responsible for causing subclinical mastitis in cows which also showed expression of virulence genesnuc, coa and spa.
135
78710
Molecular Characterization of Major Isolated Organism Involved in Bovine Subclinical Mastitis
Authors:
Abstract:
Mastitis is a common problem of dairy industries. Reduction in milk production and an irreparable damage to the udder associated with the disease are common causes of culling of dairy cows. Milk from infected animals is not suitable for drinking and for making different milk products. So, it has a major economic importance in dairy cattle. The aims of this study were to investigate the bacteriological panorama in milk from udder quarters with subclinical mastitis and to carried out for the molecular characterization of the major isolated organisms, from subclinical mastitis-affected cows in and around Durg and Rajnandgaon district of Chhattisgarh. Isolation and identification of bacteria from the milk samples of subclinical mastitis-affected cows were done by standard and routine culture procedures. A total of 78 isolates were obtained from cows and among the various bacteria isolated, Staphylococcus spp. occupied prime position with occurrence rate of 51.282%. However, other bacteria isolated includeStreptococcus spp. (20.512%), Micrococcus spp. (14.102%), E. coli (8.974%), Klebsiela spp. (2.564%), Salmonella spp. (1.282%) and Proteus spp. (1.282%). Staphylococcus spp. was isolated as the major causative agent of subclinical mastitis in the studied area. Molecular characterization of Staphylococus aureusisolates was done for genetic expression of the virulence genes like ‘nuc’ encoding thermonucleaseexoenzyme, coa and spa by PCR amplification of the respective genes in 25 Staphylococcus isolates. In the present study, 15 isolates (77.27%) out of 20 coagulase positive isolates were found to be genotypically positive for ‘nuc’ where as 20 isolates (52.63%) out of 38 CNS expressed the presence of the same virulence gene. In the present study, three Staphylococcus isolates were found to be genotypically positive for coa gene. The Amplification of the coa gene yielded two different products of 627, 710 bp. The amplification of the gene segment encoding the IgG binding region of protein A (spa) revealed a size of 220 and 253bp in twostaphylococcus isolates. The X-region binding of the spa gene produced an amplicon of 315 bp in one Staphylococcal isolates. Staphylococcus aureus was found to be major isolate (51.28%) responsible for causing subclinical mastitis in cows which also showed expression of virulence genesnuc, coa and spa.
134
75633
Molecular Characterization of Major Isolated Organism Involved in Bovine Subclinical Mastitis
Abstract:
Mastitis is a common problem of dairy industries. Reduction in milk production and an irreparable damage to the udder associated with the disease are common causes of culling of dairy cows. Milk from infected animals is not suitable for drinking and for making different milk products. So, it has a major economic importance in dairy cattle. The aims of this study were to investigate the bacteriological panorama in milk from udder quarters with subclinical mastitis and to carried out for the molecular characterization of the major isolated organisms, from subclinical mastitis-affected cows in and around Durg and Rajnandgaon district of Chhattisgarh. Isolation and identification of bacteria from the milk samples of subclinical mastitis-affected cows were done by standard and routine culture procedures. A total of 78 isolates were obtained from cows and among the various bacteria isolated, Staphylococcus spp. occupied prime position with occurrence rate of 51.282%. However, other bacteria isolated includeStreptococcus spp. (20.512%), Micrococcus spp. (14.102%), E. coli (8.974%), Klebsiela spp. (2.564%), Salmonella spp. (1.282%) and Proteus spp. (1.282%). Staphylococcus spp. was isolated as the major causative agent of subclinical mastitis in the studied area. Molecular characterization of Staphylococus aureusisolates was done for genetic expression of the virulence genes like ‘nuc’ encoding thermonucleaseexoenzyme, coa and spa by PCR amplification of the respective genes in 25 Staphylococcus isolates. In the present study, 15 isolates (77.27%) out of 20 coagulase positive isolates were found to be genotypically positive for ‘nuc’ where as 20 isolates (52.63%) out of 38 CNS expressed the presence of the same virulence gene. In the present study, three Staphylococcus isolates were found to be genotypically positive for coa gene. The Amplification of the coa gene yielded two different products of 627, 710 bp. The amplification of the gene segment encoding the IgG binding region of protein A (spa) revealed a size of 220 and 253bp in twostaphylococcus isolates. The X-region binding of the spa gene produced an amplicon of 315 bp in one Staphylococcal isolates. Staphylococcus aureus was found to be major isolate (51.28%) responsible for causing subclinical mastitis in cows which also showed expression of virulence genesnuc, coa and spa.
133
12516
Gene Expressions in Left Ventricle Heart Tissue of Rat after 150 Mev Proton Irradiation
Abstract:
Introduction: In mediastinal radiotherapy and to a lesser extend also in total-body irradiation (TBI) radiation exposure may lead to development of cardiac diseases. Radiation-induced heart disease is dose-dependent and it is characterized by a loss of cardiac function, associated with progressive heart cells degeneration. We aimed to determine the in-vivo radiation effects on fibronectin, ColaA1, ColaA2, galectin and TGFb1 gene expression levels in left ventricle heart tissues of rats after irradiation. Material and method: Four non-treatment adult Wistar rats as control group (group A) were selected. In group B, 4 adult Wistar rats irradiated to 20 Gy single dose of 150 Mev proton beam locally in heart only. In heart plus lung irradiate group (group C) 4 adult rats was irradiated by 50% of lung laterally plus heart radiation that mentioned in before group. At 8 weeks after radiation animals sacrificed and left ventricle heart dropped in liquid nitrogen for RNA extraction by Absolutely RNA® Miniprep Kit (Stratagen, Cat no. 400800). cDNA was synthesized using M-MLV reverse transcriptase (Life Technologies, Cat no. 28025-013). We used Bio-Rad machine (Bio Rad iQ5 Real Time PCR) for QPCR testing by relative standard curve method. Results: We found that gene expression of fibronectin in group C significantly increased compared to control group, but it was not showed significant change in group B compared to group A. The levels of gene expressions of Cola1 and Cola2 in mRNA did not show any significant changes between normal and radiation groups. Changes of expression of galectin target significantly increased only in group C compared to group A. TGFb1 expressions in group C more than group B showed significant enhancement compared to group A. Conclusion: In summary we can say that 20 Gy of proton exposure of heart tissue may lead to detectable damages in heart cells and may distribute function of them as a component of heart tissue structure in molecular level.
132
22436
Apoptosis Pathway Targeted by Thymoquinone in MCF7 Breast Cancer Cell Line
Abstract:
Array-based gene expression analysis is a powerful tool to profile expression of genes and to generate information on therapeutic effects of new anti-cancer compounds. Anti-apoptotic effect of thymoquinone was studied in MCF7 breast cancer cell line using gene expression profiling with cDNA micro array. The purity and yield of RNA samples were determined using RNeasyPlus Mini kit. The Agilent RNA 6000 Nano LabChip kit evaluated the quantity of the RNA samples. AffinityScript RT oligo-dT promoter primer was used to generate cDNA strands. T7 RNA polymerase was used to convert cDNA to cRNA. The cRNA samples and human universal reference RNA were labelled with Cy-3-CTP and Cy-5-CTP, respectively. Feature Extraction and GeneSpring software analysed the data. The single experiment analysis revealed involvement of 64 pathways with up-regulated genes and 78 pathways with down-regulated genes. The MAPK and p38-MAPK pathways were inhibited due to the up-regulation of PTPRR gene. The inhibition of p38-MAPK suggested up-regulation of TGF-ß pathway. Inhibition of p38 - MAPK caused up-regulation of TP53 and down-regulation of Bcl2 genes indicating involvement of intrinsic apoptotic pathway. Down-regulation of CARD16 gene as an adaptor molecule regulated CASP1 and suggested necrosis-like programmed cell death and involvement of caspase in apoptosis. Furthermore, down-regulation of GPCR, EGF-EGFR signalling pathways suggested reduction of ER. Involvement of AhR pathway which control cytochrome P450 and glucuronidation pathways showed metabolism of Thymoquinone. The findings showed differential expression of several genes in apoptosis pathways with thymoquinone treatment in estrogen receptor-positive breast cancer cells.
131
30147
Transcriptomic Analyses of Kappaphycus alvarezii under Different Wavelengths of Light
Abstract:
Transcriptomes associated with the process of photosynthesis have offered insights into the mechanism of gene regulation in terrestrial plants; however, limited information is available as far as macroalgae are concerned. This investigation aims to decipher the underlying mechanisms associated with photosynthesis in the red alga, Kappaphycus alvarezii, by performing a differential expression analysis on a de novo assembled transcriptomes. Comparative analysis of gene expression was designed to examine the alteration of light qualities and its effect on physiological mechanisms in the red alga. High-throughput paired-end RNA-sequencing was applied to profile the transcriptome of K. alvarezii irradiated with different wavelengths of light (blue 492-455 nm, green 577-492 nm and red 780-622 nm) as compared to the full light spectrum, resulted in more than 60 million reads individually and assembled using Trinity and SOAPdenovo-Trans. The transcripts were annotated in the NCBI non-redundant (nr) protein, SwissProt, KEGG and COG databases with a cutoff E-value of 1e-5 and nearly 30% of transcripts were assigned to functional annotation by Blast searches. Differential expression analysis was performed using edgeR. The DEGs were designated to six categories: BL (blue light) regulated, GL (green light) regulated, RL (red light) regulated, BL or GL regulated, BL or RL regulated, GL or RL regulated, and either BL, GL or RL regulated. These DEGs were mapped to terms in KEGG database and compared with the whole transcriptome background to search for genes that regulated by light quality. The outcomes of this study will enhance our understanding of molecular mechanisms underlying light-induced responses in red algae.
130
85260
Protective Effect of Vitamin D on Cardiac Apoptosis in Obese Rats
Abstract:
Obesity and vitamin D deficiency have both been related to cardiovascular disease. The present work aimed to investigate the possible protective effect of vitamin D on cardiac apoptosis in a rat model of dietary-induced obesity. Methods: 30 male Wistar rats included in this study. They were allocated into 4 groups: Control (n=5), animal were fed standard diet for 3 months: Control + vitamin D (VD) (n=5),animals were fed a standard diet with 400IU VD/kg for 3 months: hypercaloric diets group (n=10), animals were fed a high fat diet for 3 months: hypercaloric diet with VD group (n=10), animals were fed a high fat diet with 400IU VD/kg for 3 months. At the beginning of the experiment, the weight and length were measured to assess body mass index (BMI) and repeated every 45 days. Food intake and body weight were monitored throughout the study period. Then rats were sacrificed and heart tissues collected for Quantitative Real-time polymerase chain reaction (qRT-PCR). qRT-PCR used to detect different genetic markers of apoptosis (anti-apoptotic gene (BCL2), a pro-apoptotic gene(BAX), pro-apoptotic genes (FAS, FAS-L), tumour necrosis factor (TNF), mitogen-activated protein kinases (MAPK). Results: FAS and FAS-L gene expression were significantly upregulated in rats fed with high fat diet. And FAS-L gene expression was significantly upregulated in all groups on comparison with control. Whereas Bax gene expression was significantly downregulated in rats fed with high-fat diet supplied with vitamin D. TNF was significantly upregulated in rats fed with high-fat diet treated with vitamin D. MAPK was significantly upregulated in rats fed with high fat diet group, and in rats fed with high-fat diet supplied with vitamin D. Conclusion: The cardiac apoptotic pathways were more activated in rats fed with high-fat than lean rats. And vitamin D protect the heart from the cardiac mitochondrial-dependent apoptotic pathway.
129
74581
Classification of Multiple Cancer Types with Deep Convolutional Neural Network
Abstract:
Thousands of patients with metastatic tumors were diagnosed with cancers of unknown primary sites each year. The inability to identify the primary cancer site may lead to inappropriate treatment and unexpected prognosis. Nowadays, a large amount of genomics and transcriptomics cancer data has been generated by next-generation sequencing (NGS) technologies, and The Cancer Genome Atlas (TCGA) database has accrued thousands of human cancer tumors and healthy controls, which provides an abundance of resource to differentiate cancer types. Meanwhile, deep convolutional neural networks (CNNs) have shown high accuracy on classification among a large number of image object categories. Here, we utilize 25 cancer primary tumors and 3 normal tissues from TCGA and convert their RNA-Seq gene expression profiling to color images; train, validate and test a CNN classifier directly from these images. The performance result shows that our CNN classifier can archive >80% test accuracy on most of the tumors and normal tissues. Since the gene expression pattern of distant metastases is similar to their primary tumors, the CNN classifier may provide a potential computational strategy on identifying the unknown primary origin of metastatic cancer in order to plan appropriate treatment for patients.
128
10002
Lipopolysaccharide Induced Avian Innate Immune Expression in Heterophils
Abstract:
Although chicken strains show differences in susceptibility to a number of diseases, the underlying immunological basis is yet to be elucidated. In the present study, heterophils were subjected to LPS stimulation and total RNA extraction, further differential gene expression was studied in broiler, layer and indigenous Aseel strain by Real Time RT-PCR at different time periods before and after induction. The expression of the 14 AvBDs and chTLR 1, 2, 3, 4, 5, 7, 15 and 21 was detectable in heterophils. The expression level of most of the AvBDs significantly increased (P< 0.05) 3 hours post in vitro lipopolysaccharide challenge. Higher expression level and stronger activation of most AvBDs, NFkB-1 and IRF-3 in heterophils was observed, with the stimulation of LPS in layer compared to broiler, and in Aseel compared to both layer and broiler. This investigation will allow more refined interpretation of immuno-genetic basis of the variable disease resistance/susceptibility in divergent stock of chicken including indigenous breed. Moreover this study will be helpful in formulation of strategy for isolation of antimicrobial peptides from heterophils.
127
79615
Transcriptomic and Translational Regulation of Peroxisome Proliferator-Activated Receptors after Different Feedings in Salmon
Abstract:
Data from the Norwegian Directorate of Fisheries reported that >1.2 million tons of Atlantic salmon were produced in Norway aquaculture industry in 2016. Peroxisome proliferator-activated receptors (PPARs) are one of the key transcription factor families that respond to nutritional ligands. Recent studies have shown the connection between PPARs with lipid and carbohydrate metabolism in aquaculture. To our knowledge, there is no published data about the effects of krill meal, soybean meal, Bactocell ® and butyrate feedings compared to control group on PPARs gene and protein expressions in Atlantic salmon. Fish, 1year +postsmolt, average weight 250 gram were cultured for 12 weeks after acclimatization by control commercial feeding in 2 weeks after hatchery. Water oxygen rate, salinity, and temperature were monitored every second day. At the end of the trial, fish were taken from tanks randomly, and four replicates per group were collected and stored in -80 freezers until analysis. Total RNA extracted from posterior part of dorsal fin muscle tissues and Nanodrop and Bioanalyzer was used to check the quality of RNA. Gene expression of PPAR α, β and γ were determined by RT-PCR. The expression of genes of interest was measured relative to control group after normalization to three reference genes. Total protein concentration was calculated by Bradford method, and protein expression was determined with primary PPARγ antibody by western blot. All data were analyzed by ANOVA followed by Benjamini-Hochberg and Bonferroni tests. Probability values < 0.05 considered significant. Bactocell® and butyrate groups showed significantly lower PPARα expression. PPARβ and γ were not significantly different among groups. PPARγ mRNA expression was approximately consistent with protein expression pattern, except than butyrate group showed lower mRNA level. The order of PPARγ expression was Bactocell® > soy meal > butyrate > krill meal > control respectively. PPARβ gene expression decreased more in soy meal > butyrate > krill meal > Bactocell® > control groups respectively. In conclusion, the increased expression of PPARγ and α is proposed to represent a reduction tendency of lipid storage in fish fed by Bactocell®, butyrate, soy and krill meal.
126
48232
Q Eqchi Mayan Piper and Cissampelos Species Alter Reporter Genes and Endogenous Genes Expression in Mc-7 Cells
Abstract:
Introduction: The genus piperaceae contains approximately 1000 species of herbs scrubs small trees and hanging vines distributed in both hemispheres. During our ethno medical work in Guatemala of the 27 plant families documented for us e by the Qeqchi Maya for reproductive disorders the most prominent were the Piperaceae (15%) and Menispermiaceae. Our Previous work showed that extracts from form Piper and Cissampelos species bound to both and progesterone and the estrogen receptors. In this work active extracts from Piper aeruginosibaccum Trelease, P auritum, P tuerckheimii and Cissampels tropaeolifolia were tested in functionalized cell based assays including a SEAP reporter gene and by qPCR of ER-responsive gene expression in MCF-7cells. In the reporter gene assay P aeruginosibaccum was estrogenic and enhanced E2 EFFECTS IN MCF-7 CELLS. P. tuerckheimi was not estrogenic alone but significantly enhanced the effects of E2 on SEAP reporter gene expression. Both altered mRNA expression of E2 responsive genes in MCF-7. Methods: this is collaborative project between University of Illinois at Chicago and University of San Carlos Guatemala City. 144 spices of plants were collected in Guatemala of which 57 used to treat a variety of women's reproductive health. The Genus Piperaraceae contains approximately 1000 species of herbs scrubs and small trees. Active extracts of the plants were tested in functionalized in cell-based bioassays including SEAP reporter genes. Results demonstrated altered mRNA expression of E2 responsive genes in MC-7 cells plants were collected in Guatemala of which 57 used. Conclusion of the 5 plants tested all were shown to contain components of binding to estrogenic receptor to a greater or lesser degree. These effects support the use of QEqchi Maya women in Guatemala for reproductive.
125
41377
LncRNA NEAT1 Promotes NSCLC Progression through Acting as a ceRNA of miR-377-3p
Abstract:
Recently, the long non-coding RNA (lncRNA) NEAT1 has been identified as an oncogenic gene in multiple cancer types and elevated expression of NEAT1 was tightly linked to tumorigenesis and cancer progression. However, the molecular basis for this observation has not been characterized in progression of non-small cell lung cancer (NSCLC). In our studies, we identified NEAT1 was highly expressed in NSCLC patients and was a novel regulator of NSCLC progression. Patients whose tumors had high NEAT1 expression had a shorter overall survival than patients whose tumors had low NEAT1 expression. Further, NEAT1 significantly accelerates NSCLC cell growth and metastasis in vitro and tumor growth in vivo. Additionally, by using bioinformatics study and RNA pull down combined with luciferase reporter assays, we demonstrated that NEAT1 functioned as a competing endogenous RNA (ceRNA) for has-miR-377-3p, antagonized its functions and led to the de-repression of its endogenous targets E2F3, which was a core oncogene in promoting NSCLC progression. Taken together, these observations imply that the NEAT1 modulated the expression of E2F3 gene by acting as a competing endogenous RNA, which may build up the missing link between the regulatory miRNA network and NSCLC progression.
124
67686
Transcriptome Analysis Reveals Role of Long Non-Coding RNA NEAT1 in Dengue Patients
Abstract:
Background: Long non-coding RNAs (lncRNAs) are the important regulators of gene expression and play important role in viral replication and disease progression. The role of lncRNA genes in the pathogenesis of Dengue virus-mediated pathogenesis is currently unknown. Methods: To gain additional insights, we utilized an unbiased RNA sequencing followed by in silico analysis approach to identify the differentially expressed lncRNA and genes that are associated with dengue disease progression. Further, we focused our study on lncRNAs NEAT1 (Nuclear Paraspeckle Assembly Transcript 1) as it was found to be differentially expressed in PBMC of dengue infected patients. Results: The expression of lncRNAs NEAT1, as compared to dengue infection (DI), was significantly down-regulated as the patients developed the complication. Moreover, pairwise analysis on follow up patients confirmed that suppression of NEAT1 expression was associated with rapid fall in platelet count in dengue infected patients. Severe dengue patients (DS) (n=18; platelet count < 20K) when recovered from infection showing high NEAT1 expression as it observed in healthy donors. By co-expression network analysis and subsequent validation, we revealed that coding gene; IFI27 expression was significantly up-regulated in severe dengue cases and negatively correlated with NEAT1 expression. To discriminate DI from dengue severe, receiver operating characteristic (ROC) curve was calculated. It revealed sensitivity and specificity of 100% (95%CI: 85.69 – 97.22) and area under the curve (AUC) = 0.97 for NEAT1. Conclusions: Altogether, our first observations demonstrate that monitoring NEAT1and IFI27 expression in dengue patients could be useful in understanding dengue virus-induced disease progression and may be involved in pathophysiological processes.
123
27427
Intra-miR-ExploreR, a Novel Bioinformatics Platform for Integrated Discovery of MiRNA:mRNA Gene Regulatory Networks
Abstract:
miRNAs have emerged as key post-transcriptional regulators of gene expression, however identification of biologically-relevant target genes for this epigenetic regulatory mechanism remains a significant challenge. To address this knowledge gap, we have developed a novel tool in R, Intra-miR-ExploreR, that facilitates integrated discovery of miRNA targets by incorporating target databases and novel target prediction algorithms, using statistical methods including Pearson and Distance Correlation on microarray data, to arrive at high confidence intragenic miRNA target predictions. We have explored the efficacy of this tool using Drosophila melanogaster as a model organism for bioinformatics analyses and functional validation. A number of putative targets were obtained which were also validated using qRT-PCR analysis. Additional features of the tool include downloadable text files containing GO analysis from DAVID and Pubmed links of literature related to gene sets. Moreover, we are constructing interaction maps of intragenic miRNAs, using both micro array and RNA-seq data, focusing on neural tissues to uncover regulatory codes via which these molecules regulate gene expression to direct cellular development.
122
60378
The Role of Leukocyte-Derived IL-10 on Postoperative ileus and Intestinal Macrophage Differentiation in Mice
Abstract:
Objective: Postoperative ileus (POI) is a common complication of abdominal surgery. Monocyte infiltration is a hallmark of POI. The polarization of macrophages/monocytes in this process is not well understood. We aimed to investigate if and how M2 macrophage/monocyte differentiation is involved in POI pathogenesis. Design: POI was induced by intestinal manipulation (IM). C57Bl/6, CCR2-/-, IL-10 reporter (ITIB), IL-10-/- and LysMcre/IL-10fl/fl mice underwent IM. At various points in time leukocyte influx, gene and protein expression of cytokines, chemokines and M2 differentiation markers and intestinal motility were analyzed. Results: IM induced the postoperative expression of the M2 markers Arginase-1 and YM-1, predominantly in F4/80+Ly6C+ monocytes. Gene expression analyses indicated an IL-10-dependent, IL-4-independent M2 polarization of these monocytes. IL-10 dependency of M2 differentiation was confirmed in IL-10 deficient mice. Leukocytes, in the order of infiltrating monocytes, neutrophils, and resident macrophages were the main IL-10 producers during POI. IL-10 producing monocytes as well as M2 marker expression were almost absent in CCR2-deficient mice. However, postoperative IL-10 expression was not altered in CCR2-/- mice. The loss of M2 polarized monocytes neither protected CCR2-/- mice from nor affected resolution of POI. In contrast, IL-10 deficiency reduced postoperative neutrophil numbers and ameliorated POI. IL-10Ra expression was strongly induced in neutrophils but not in monocytes. Conclusion: We conclude that IL-10 counteracts POI resolution by activating IL-10Ra-expressing neutrophils in the late phase of disease while IL-10-dependent M2 differentiation is not pivotal to POI manifestation and resolution.
121
55557
Photocaged Carbohydrates: Versatile Tools for Biotechnological Applications
Abstract:
Light absorbing chromophoric systems are important optogenetic tools for biotechnical and biophysical investigations. Processes such as fluorescence or photolysis can be triggered by light-absorption of chromophores. These play a central role in life science. Photocaged compounds belong to such chromophoric systems. The photo-labile protecting groups enable them to release biologically active substances with high temporal and spatial resolution. The properties of photocaged compounds are specified by the characteristics of the caging group as well as the characteristics of the linked effector molecule. In our research, we work with different types of photo-labile protecting groups and various effector molecules giving us possible access to a large library of caged compounds. As a function of the caged effector molecule, a nearly limitless number of biological systems can be directed. Our main interest focusses on photocaging carbohydrates (e.g. arabinose) and their derivatives as effector molecules. Based on these resulting photocaged compounds a precisely controlled photoinduced gene expression will give us access to studies of numerous biotechnological and synthetic biological applications. It could be shown, that the regulation of gene expression via light is possible with photocaged carbohydrates achieving a higher-order control over this processes. With the one-step cleavable photocaged carbohydrate, a homogeneous expression was achieved in comparison to free carbohydrates.
120
90791
Association of Nuclear – Mitochondrial Epistasis with BMI in Type 1 Diabetes Mellitus Patients
Abstract:
Obesity results from an imbalance between energy intake and its expenditure. Genome-Wide Association Study (GWAS) analyses have led to discovery of only about 100 variants influencing body mass index (BMI), which explain only a small portion of genetic variability. Analysis of gene epistasis gives a chance to discover another part. Since it was shown that interaction and communication between nuclear and mitochondrial genome are indispensable for normal cell function, we have looked for epistatic interactions between the two genomes to find their correlation with BMI. Methods: The analysis was performed on 366 T1DM patients using Illumina Infinium OmniExpressExome-8 chip and followed by imputation on Michigan Imputation Server. Only genes which influence mitochondrial functioning (listed in Human MitoCarta 2.0) were included in the analysis – variants of nuclear origin (MAF > 5%) in 1140 genes and 42 mitochondrial variants (MAF > 1%). Gene expression analysis was performed on GTex data. Association analysis between genetic variants and BMI was performed with the use of Linear Mixed Models as implemented in the package 'GENESIS' in R. Analysis of association between mRNA expression and BMI was performed with the use of linear models and standard significance tests in R. Results: Among variants involved in epistasis between mitochondria and nucleus we have identified one in mitochondrial transcription factor, TFB2M (rs6701836). It interacted with mitochondrial variants localized to MT-RNR1 (p=0.0004, MAF=15%), MT-ND2 (p=0.07, MAF=5%) and MT-ND4 (p=0.01, MAF=1.1%). Analysis of the interaction between nuclear variant rs6701836 (nuc) and rs3021088 localized to MT-ND2 mitochondrial gene (mito) has shown that the combination of the two led to BMI decrease (p=0.024). Each of the variants on its own does not correlate with higher BMI [p(nuc)=0.856, p(mito)=0.116)]. Although rs6701836 is intronic, it influences gene expression in the thyroid (p=0.000037). rs3021088 is a missense variant that leads to alanine to threonine substitution in the MT-ND2 gene which belongs to complex I of the electron transport chain. The analysis of the influence of genetic variants on gene expression has confirmed the trend explained above – the interaction of the two genes leads to BMI decrease (p=0.0308). Each of the mRNAs on its own is associated with higher BMI (p(mito)=0.0244 and p(nuc)=0.0269). Conclusıons: Our results show that nuclear-mitochondrial epistasis can influence BMI in T1DM patients. The correlation between transcription factor expression and mitochondrial genetic variants will be subject to further analysis.
119
88136
Ring FingerPortein 2 (RNF2) Targeting by miRNAs in Breast Cancer Cell Lines
Abstract:
Ring Finger Protein 2 (RNF2) is a member of polycomb repressive complex 1 (PRC1), which is one of the epigenetic regulators in the genome. When RNF2 combines with other PRC1 members, it mediates the mono-ubiquitination of Histon2A (H2A). In breast cancer, RNF2 is commonly overexpressed, and also it promotes metastasis and invasion in other aggressive tumors like melanoma, prostate, and hepatocarcinoma. The role of RNF2 in the metastasis and invasion of breast cancer has not yet been elucidated. Our aim is to observe the role of RNF2 in metastasis and invasion in this study by miRNA mediated RNF2 gene silencing in breast cancer cell lines. We selected miRNAs, targeting to RNF2 by searching online databases. miR-17-5p, miR20a-5p, and miR-106b-5p were transfected to breast cancer cell lines (MCF-7, MDA-MB-231, SK-BR-3, and ZR-75-1), and also we used normal breast epithelial cell line (hTERT-HME1) to compare RNF2 gene expression level. After 48-72 hours post-transfection, mRNAs were isolated from the cells, and gene expressions were measured by RT-qPCR after from cDNA syntheses. We observed that RNF2 was highly expressed in SK-BR-3 and MDA-MB-231 cell lines opposite to MCF-7 and ZR-75-1 cell lines. RNF2 was downregulated 5, 5 and 7 fold by miR17-5p, miR20a-5p and miR106b-5p respectively in MCF-7. However, in SK-BR-3 and ZR-75-1 cell lines, miRNAs did not affect significantly RNF2 gene expression level. miR20a-5p decreased RNF2 3 fold and miR17-5p and miR106b-5p did not affect MDA-MB-231. After gene expression analysis, we performed metastasis and invasion assay in MCF-7 cells. For metastasis, we used both wound healing assay and Transwell Cell Migration Assay, and we used Transwell Cell Invasion Assay for invasion. The data of this assay showed that miR17-5p and miR20a-5p decreased both invasion and metastasis level, but miR106b-5p has no effect. We would like to conclude that RNF2 can be targeted by miR17-5p, miR20a-5p and miR106b-5p in MCF-7 cells and also RNF2, which is one of the upregulated genes in aggressive tumor, can be decreased by using these miRNAs. In future, we would like to confirm these results at the protein level and also whether these miRNAs are direct target of RNF2 or not.
118
91777
Frequency of BCR-ABL Fusion Transcript Types with Chronic Myeloid Leukemia by Multiplex Polymerase Chain Reaction in Srinagarind Hospital, Khon Kaen Thailand
Abstract:
Chronic myeloid leukemia (CML) is characterized by the consistent involvement of the Philadelphia chromosome (Ph), which is derived from a reciprocal translocation between chromosome 9 and 22, the main product of the t(9;22) (q34;q11) translocation, is found in the leukemic clone of at least 95% of CML patients. There are two major forms of the BCR/ABL fusion gene, involving ABL exon 2, but including different exons of BCR gene. The transcripts b2a2 (e13a2) or b3a2 (e14a2) code for a p210 protein. Another fusion gene leads to the expression of an e1a2 transcript, which codes for a p190 protein. Other less common fusion genes are b3a3 or b2a3, which codes for a p203 protein and e19a2 (c3a2) transcript, which codes for a p230 protein. Its frequency varies in different populations. In this study, we aimed to report the frequency of BCR-ABL fusion transcript types with CML by multiplex PCR (polymerase chain reaction) in Srinagarind Hospital, Khon Kaen, Thailand. Multiplex PCR for BCR-ABL was performed on 58 patients, to detect different types of BCR-ABL transcripts of the t (9; 22). All patients examined were positive for some type of BCR/ABL rearrangement. The majority of the patients (93.10%) expressed one of the p210 BCR-ABL transcripts, b3a2 and b2a2 transcripts were detected in 53.45% and 39.65% respectively. The expression of an e1a2 transcript showed 3.75%. Co-expression of p210/p230 was detected in 3.45%. Co-expression of p210/p190 was not detected. Multiplex PCR is useful, saves time and reliable in the detection of BCR-ABL transcript types. The frequency of one or other rearrangement in CML varies in different population.
117
76956
Immunolabeling of TGF-β during Muscle Regeneration
Abstract:
Muscle regeneration after injury (as irradiation) is of great importance. However, the molecular and cellular mechanisms are still unclear. Cytokines are believed to play fundamental role in the different stages of muscle regeneration. They are secreted by many cell populations, but the predominant producers are macrophages and helper T cells. On the other hand, it has been shown that adipose tissue derived stromal/stem cell (ASC) injection could improve muscle regeneration. Stem cells probably induce the coordinated modulations of gene expression in different macrophage cells. Therefore, we investigated the patterns and timing of changes in gene expression of different cytokines occurring upon stem cells loading. Muscle regeneration was studied in an irradiated muscle of minipig animal model in presence or absence of ASC treatment (irradiated and treated with ASCs, IRR+ASC; irradiated not-treated with ASCs, IRR; and non-irradiated no-IRR). We characterized macrophage populations by immunolabeling in the different conditions. In our study, we found mostly M2 and a few M1 macrophages in the IRR+ASC samples. However, only few M2b macrophages were noticed in the IRR muscles. In addition, we found intensive fibrosis in the IRR samples. With in situ hybridization and immunolabeling, we analyzed the cytokine expression of the different macrophages and we showed that M2d macrophage are the most abundant in the IRR+ASC samples. By in situ hybridization, strong expression of the transforming growth factor &beta; (TGF-&beta;) was observed in the IRR+ASC but very week in the IRR samples. But when we analyzed TGF-&beta; level with immunolabeling the expression was very different: many M2 macrophages showed week expression in IRR+ASC and few cells expressing stronger level in IRR muscles. Therefore, we investigated the MMP expressions in the different muscles. Our data showed that the M2 macrophages of the IRR+ASC muscle expressed MMP2 proteins. Our working hypothesis is that MMP2 expression of the M2 macrophages can decrease fibrosis in the IRR+ASC muscle by capturing TGF-&beta;.
116
65369
Transcriptome Analysis of Dry and Soaked Tomato (Solanum lycopersicum) Seeds in Response to Fast Neutron Irradiation
Abstract:
Fast neutron irradiation (FNI) can cause mutations on plant genome but, in the most of cases, these irradiated plants have not shown significant characteristics phenotypically. In this study, we utilized RNA-Seq to generate a high-resolution transcriptome map of the tomato (Solanum lycopersicum) genome effected by FNI. To quantify the different transcription levels in tomato irradiated by FNI, tomato seeds were irradiated by using MC-50 cyclotron (KIRAMS, Korea) for 0, 30 and 90 minutes, respectively. To investigate the effects on the pre-soaking condition, experimental groups were divided into dry and soaked seeds, which were soaked for 8 hours before irradiation. There was no noticeable difference in the percentage germination (PG) among dry seeds, while irradiated soaked seeds have about 10 % lower PG compared to the unirradiated control group. Using whole transcriptome sequencing by HiSeq 2000, we analyzed the differential gene expression in response to different time of FNI in dry and soaked seeds. More than 1.4 million base pair reads were mapped onto the tomato reference genome and the expression pattern differences between irradiated and unirradiated seeds were assessed. In 0, 30 and 90 minutes irradiation, 12,135, 28,495 and 28,675 transcripts were generated, respectively. Gene ontology analysis suggested the different enrichment of transcripts involved in response to different FNI. The present study showed that FNI effects on plant gene expression, which can become a new parameters for evaluating the responses against FNI on plants. In addition, the comparative analysis of differentially expressed genes in D and S seeds by FNI will also give us a chance to deep explore novel candidate genes for FNI, which could be a good model system to understand the mechanisms behind the adaption of plant to space biology research.
115
27942
Expression of Human Papillomavirus Type 18 L1 Virus-Like Particles in Methylotropic Yeast, Pichia Pastoris
Abstract:
Human papillomavirus type 16 and 18 are closely associated with the development of human cervical carcinoma, which is one of the most common causes of cancer death in women worldwide. At present, HPV type 18 accounts for about 34 % of all HPV infections in Iran and the most promising vaccine against HPV infection is based on the L1 major capsid protein. The L1 protein of HPV18 has the capacity to self-assemble into capsomers or virus-like particles (VLPs) that are non-infectious, highly immunogenic and allowing their use in vaccine production. The methylotrophic yeast Pichia pastoris is an efficient and inexpensive expression system used to produce high levels of heterologous proteins. In this study we expressed HPV18 L1 VLPs in P. pastoris. The gene encoding the major capsid protein L1 of the high-risk HPV type 18 was isolated from Iranian patient by PCR and inserted into pTG19-T vector to obtain the recombinant expression vector pTG19-HPV18-L1. Then, the pTG19-HPV18-L1 was transformed into E. coli strain DH5α and the recombinant protein HPV18 L1 was expressed under IPTG induction in soluble form. The HPV18 L1 gene was excised from recombinant plasmid with XhoI and EcoRI enzymes and ligated into the yeast expression vector pPICZα linearized with the same enzymes, and transformed into P. pastoris. Induction and expression of HPV18 L1 protein was demonstrated by BMGY/BMMY and RT PCR. The parameters for induced cultivation for strain in P. pastoris KM71 with HPV16L1 were investigated in shaking flask cultures. After induced cultivation BMMY (pH 7.0) medium supplemented with methanol to a final concentration of 1.0% every 24 h at 37 degrees C for 96 h, the recombinant produced 78.6 mg/L of L1 protein. This work offers the possibility for the production of prophylactic vaccine for cervical carcinoma by P. pastoris for HPV-18 L1 gene. The VLP-based HPV vaccines can prevent persistent HPV18 infections and cervical cancer in Iran. The HPV-18 L1 gene was expressed successfully in E.coli, which provides necessary basis for preparing HPV-18 L1 vaccine in human. Also, HPV type 6 L1 proteins expressed in Pichia pastoris will facilitate the HPV vaccine development and structure-function study.
114
119322
Bio-Genetic Activities Associated with Resistant in Peppers to Phytophthora capsici
Abstract:
Root and collar rot disease caused by Phytophthora capsici (Leonian) is one of the most serious diseases in pepper, Capsicum annuum L. In this study, a diverse collection of 37 commercial edible and ornamental pepper genotypes infected with P. capsici were investigated for biomass parameters and enzymatic activity of peroxidase or peroxide reductases (EC), superoxide dismutase (SOD), polyphenol oxidase (PPOs), catalase (CAT) and phenylalanine ammonia-lyase (PAL). Seven candidate DEG genes were also evaluated on resistant and susceptible pepper cultivars, through measuring product formation, using spectrophotometry and real-time polymerase chain reaction. All the five enzymes and seven defense-gene candidates were up-regulated in all inoculated pepper accessions to P. capsici. But, the enzymes and DEG genes were highly expressed in resistant cv. 19OrnP-PBI, 37ChillP-Paleo, and “23CherryP-Orsh". The expression level of enzymes were 1.5 to 5.6-fold higher in the resistant peppers, than the control non-inoculated genotypes. Also, the transcriptional levels of related candidate DEG genes were 3.16 to 5.90-fold higher in the resistant genotypes. There was a direct and high correlation coefficient between resistance, bio-mass parameters, enzymatic activity, and resistance gene expression. The related enzymes and candidate genes expressed herein will provide a basis for further gene cloning and functional verification studies, and also will aid in an understanding of the regulatory mechanism of pepper resistance to P. capsici.
113
113837
Biocultural Biographies and Molecular Memories: A Study of Neuroepigenetics and How Trauma Gets under the Skull
Abstract:
In the wake of the Human Genome Project, the life sciences have undergone some fascinating changes. In particular, conventional beliefs relating to gene expression are being challenged by advances in postgenomic sciences, especially by the field of epigenetics. Epigenetics is the modification of gene expression without changes in the DNA sequence. In other words, epigenetics dictates that gene expression, the process by which the instructions in DNA are converted into products like proteins, is not solely controlled by DNA itself. Unlike gene-centric theories of heredity that characterized much of the 20th Century (where the genes were considered as having almost god-like power to create life), gene expression in epigenetics insists on environmental ‘signals’ or ‘exposures’, a point that radically deviates from gene-centric thinking. Science and Technology Studies (STS) scholars have shown that epigenetic research is having vast implications for the ways in which chronic, non-communicable diseases are conceptualized, treated, and governed. However, to the author’s knowledge, there have not yet been any in-depth sociological engagements with neuroepigenetics that examine how the field is affecting mental health and trauma discourse. In this paper, the author discusses preliminary findings from a doctoral ethnographic study on neuroepigenetics, trauma, and embodiment. Specifically, this study investigates the kinds of causal relations neuroepigenetic researchers are making between experiences of trauma and the development of mental illnesses like complex post-traumatic stress disorder (PTSD), both throughout a human’s lifetime and across generations. Using qualitative interviews and nonparticipant observation, the author focuses on two public-facing research centers based in Melbourne: Florey Institute of Neuroscience and Mental Health (FNMH), and Murdoch Children’s Research Institute (MCRI). Preliminary findings indicate that a great deal of ambiguity characterizes this infant field, particularly when animal-model experiments are employed and the results are translated into human frameworks. Nevertheless, researchers at the FNMH and MCRI strongly suggest that adverse and traumatic life events have a significant effect on gene expression, especially when experienced during early development. Furthermore, they predict that neuroepigenetic research will have substantial implications for the ways in which mental illnesses like complex PTSD are diagnosed and treated. These preliminary findings shed light on why medical and health sociologists have good reason to be chiming in, engaging with and de-black-boxing ideations emerging from postgenomic sciences, as they may indeed have significant effects for vulnerable populations not only in Australia but other developing countries in the Global South.
112
99049
The Role of the STAT3 Signaling for Melatonergic Synthetic Pathway in the Rat Pineal Gland
Abstract:
The pineal gland of the vertebrate brain is a circumventricular organ which serves as a major neuroendocrine gland with the primary function of rhythmic secretion of neurohormone melatonin under the control of the hypothalamic suprachiasmatic nucleus (SCN). Soon after the onset of the darkness, the activity of the key rate-limiting enzyme for melatonin synthesis, arylalkylamine N-acetyltransferase (AANAT), raises due to the increased release of norepinephrine from sympathetic neurons terminating on the parenchymal cells where it binds to β-adrenergic receptors. Melatonin codes the length of the night, and it is well recognized for its anti-inflammatory effects. However, to our knowledge, less is known about the effect of the immune system on the melatonin biosynthesis and the precise role of the STAT3 in the signaling pathway leading to the expression of AANAT. Lipopolysaccharide (LPS) is the essential component in the outer surface membrane of gram-negative bacteria and acts as a strong stimulator of natural and innate immunity. STAT3 acts as an important factor in immune response. Here we investigated the effect of LPS on the components of the melatonergic synthetic pathway in the pineal gland. The experiments were performed both in vivo and in vitro. The changes in AANAT activity were determined by radioenzymatic assay. PCR analyses were carried out to detect aa-nat, icer, spi-3 and stat3 gene expression. From our results, it is apparent that the high basal level of phosphorylated forms of STAT3 can be elevated after systemic as well as in vitro administration of LPS. Our experiments have shown that LPS reduces melatonin synthesis, nevertheless, the activity of AANAT was increased. Moreover, the basal level of phosphorylated STAT3 counteracts β-adrenergic receptor-mediated aa-nat gene expression and sustains its own and spi-3 gene expression. In conclusion, LPS can affect immunomodulators such as melatonin in the pineal gland.
111
93351
Production of Recombinant VP2 Protein of Canine Parvovirus 2a Using Baculovirus Expression System
Abstract:
An VP2 gene from the current prevalent CPV (Canine Parvovirus) strain (new CPV-2a) in the Republic of Korea was expressed in a baculovirus expression system. Genomic DNA was extracted from the isolate strain CPV-2a. The recombinant baculovirus, containing the coding sequences of VP2 with the histidine tag at the N-terminus, were generated by using the Bac-to-Bac system. For production of the recombinant VP2 proteins, SF9 cells were transfection into 6 wells. Propagation of recombinant baculoviruses and expression of the VP2 protein were performed in the Sf9 cell line maintained. The proteins were detected to Western blot anlaysis. CPV-2a VP2 was detected by Western blotting the monoclonal antibodies recognized 6x His and the band had a molecular weight of 65 KDa. We demonstrated that recombinant CPV-2a VP2 expression in baculovirus. The recombinant CPV-2a VP2 may able to development of specific diagnostic test and vaccination of against CPV2. This study provides a foundation for application of CPV2 on the development of new CPV2 subunit vaccine.
110
54549
MAGE-A3 and PRAME Gene Expression and EGFR Mutation Status in Non-Small-Cell Lung Cancer
Abstract:
Background: The RNA-expression levels of cancer-testis antigens MAGE A3 and PRAME were determined in resected tissue from patients with primary non-small-cell lung cancer (NSCLC) and related to clinical outcome. EGFR, KRAS and BRAF mutation status was determined in a subset to investigate associations with MAGE A3 and PRAME expression. Methods: We conducted a single-centre, uncontrolled, retrospective study of 1260 tissue-bank samples from stage IA-III resected NSCLC. The prognostic value of antigen expression (qRT-PCR) was determined by hazard-ratio and Kaplan-Meier curves. Results: Thirty-seven percent (314/844) of tumours expressed MAGE-A3, 66% (723/1092) expressed PRAME and 31% (239/839) expressed both. Respective frequencies in squamous-cell tumours and adenocarcinomas were 43%/30% for MAGE A3 and 80%/44% for PRAME. No correlation with stage, tumour size or patient age was found. Overall, no prognostic value was identified for either antigen. A trend to poorer overall survival was associated with MAGE-A3 in stage IIIB and with PRAME in stage IB. EGFR and KRAS mutations were found in 10.1% (28/311) and 33.8% (97/311) of tumours, respectively. EGFR (but not KRAS) mutation status was negatively associated with PRAME expression. Conclusion: No clear prognostic value for either PRAME or MAGE A3 was observed in the overall population, although some observed trends may warrant further investigation.
109
121517
Systematic Identification of Noncoding Cancer Driver Somatic Mutations
Abstract:
Accumulation of somatic mutations (SMs) in the genome is a major driving force of cancer development. Most SMs in the tumor's genome are functionally neutral; however, some cause damage to critical processes and provide the tumor with a selective growth advantage (termed cancer driver mutations). Current research on functional significance of SMs is mainly focused on finding alterations in protein coding sequences. However, the exome comprises only 3% of the human genome, and thus, SMs in the noncoding genome significantly outnumber those that map to protein-coding regions. Although our understanding of noncoding driver SMs is very rudimentary, it is likely that disruption of regulatory elements in the genome is an important, yet largely underexplored mechanism by which somatic mutations contribute to cancer development. The expression of most human genes is controlled by multiple enhancers, and therefore, it is conceivable that regulatory SMs are distributed across different enhancers of the same target gene. Yet, to date, most statistical searches for regulatory SMs have considered each regulatory element individually, which may reduce statistical power. The first challenge in considering the cumulative activity of all the enhancers of a gene as a single unit is to map enhancers to their target promoters. Such mapping defines for each gene its set of regulating enhancers (termed "set of regulatory elements" (SRE)). Considering multiple enhancers of each gene as one unit holds great promise for enhancing the identification of driver regulatory SMs. However, the success of this approach is greatly dependent on the availability of comprehensive and accurate enhancer-promoter (E-P) maps. To date, the discovery of driver regulatory SMs has been hindered by insufficient sample sizes and statistical analyses that often considered each regulatory element separately. In this study, we analyzed more than 2,500 whole-genome sequence (WGS) samples provided by The Cancer Genome Atlas (TCGA) and The International Cancer Genome Consortium (ICGC) in order to identify such driver regulatory SMs. Our analyses took into account the combinatorial aspect of gene regulation by considering all the enhancers that control the same target gene as one unit, based on E-P maps from three genomics resources. The identification of candidate driver noncoding SMs is based on their recurrence. We searched for SREs of genes that are "hotspots" for SMs (that is, they accumulate SMs at a significantly elevated rate). To test the statistical significance of recurrence of SMs within a gene's SRE, we used both global and local background mutation rates. Using this approach, we detected - in seven different cancer types - numerous "hotspots" for SMs. To support the functional significance of these recurrent noncoding SMs, we further examined their association with the expression level of their target gene (using gene expression data provided by the ICGC and TCGA for samples that were also analyzed by WGS).
108
39983
In Silico Analysis of Salivary miRNAs to Identify the Diagnostic Biomarkers for Oral Cancer
Abstract:
Oral squamous cell carcinoma (OSCC) is one of the most common cancers worldwide. Recent studies have highlighted the role of miRNA in disease pathology, indicating its potential use in an early diagnostic tool. miRNAs are small, double stranded, non-coding RNAs that regulate gene expression by deregulating mRNAs. miRNAs play important roles in modifying various cellular processes such as cell growth, differentiation, apoptosis, and immune response. Dis-regulated expression of miRNAs is known to affect the cell growth, and this may function as tumor suppressors or oncogenes in various cancers. Objectives: The main objectives of this study were to characterize the extracellular miRNAs involved in oral cancer (OC) to assist early detection of cancer as well as to propose a list of genes that can potentially be used as biomarkers of OC. We used gene expression data by microarrays already available in literature. Materials and Methods: In the first step, a total of 318 miRNAs involved in oral carcinoma were shortlisted followed by the prediction of their target genes. Simultaneously, the differentially expressed genes (DEGs) of oral carcinoma from all experiments were identified. The common genes between lists of DEGs of OC based on experimentally proven data and target genes of each miRNA were identified. These common genes are the targets of specific miRNA, which is involved in OC. Finally, a list of genes was generated which may be used as biomarker of OC. Results and Conclusion: In results, we included some of pathways in cancer to show the change in gene expression under the control of specific miRNA. Ingenuity pathway analysis (IPA) provided a list of major biomarkers like CDH2, CDK7 and functional enrichment analysis identified the role of miRNA in major pathways like cell adhesion molecules pathway affected by cancer. We observed that at least 25 genes are regulated by maximum number of miRNAs, and thereby, they can be used as biomarkers of OC. To better understand the role of miRNA with respect to their target genes further experiments are required, and our study provides a platform to better understand the miRNA-OC relationship at genomics level.
107
37764
Identification of Mx Gene Polymorphism in Indragiri Hulu duck by PCR-RFLP
Abstract:
The amino acid variation of Asn (allele A) at position 631 in Mx gene was specific to positive antiviral to avian viral desease. This research was aimed at identifying polymorphism of Mx gene in duck using molecular technique. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) technique was used to select the genotype of AA, AG and GG. There were thirteen duck from Indragiri Hulu regency (Riau Province) used in this experiment. DNA amplification results showed that the Mx gene in duck is found in a 73 bp fragment. Mx gene in duck did not show any polymorphism. The frequency of the resistant allele (AA) was 0%, while the frequency of the susceptible allele (GG) was 100%.
106
48451
Relative Expression and Detection of MUB Adhesion Domains and Plantaricin-Like Bacteriocin among Probiotic Lactobacillus plantarum-Group Strains Isolated from Fermented Foods
Abstract:
The immemorial use of fermented foods from vegetables, dairy and other biological sources are of great demand in India because of their health benefits. However, the diversity of Lactobacillus plantarum group (LPG) of vegetable origin has not been revealed yet, particularly with reference to their probiotic functionalities. In the present study, the different species of probiotic Lactobacillus plantarum group (LPG) i.e., L. plantarum subsp. plantarum MTCC 5422 (from fermented cereals), L. plantarum subsp. argentoratensis FG16 (from fermented bamboo shoot) and L. paraplantarum MTCC 9483 (from fermented gundruk) (as characterized by multiplex recA PCR assay) were considered to investigate their relative expression of MUB domains of mub gene (mucin binding protein) by Real time PCR. Initially, the allelic variation in the mub gene was assessed and found to encode three different variants (Type I, II and III). All the three types had 8, 9 and 10 MUB domains respectively (as analysed by Pfam database) and were found to be responsible for adhesion of bacteria to the host intestinal epithelial cells. These domains either get inserted or deleted during speciation or evolutionary events and lead to divergence. The reverse transcriptase qPCR analysis with mubLPF1+R1 primer pair supported variation in amplicon sizes with 300, 500 and 700 bp among different LPG strains. The relative expression of these MUB domains significantly unregulated in the presence of 1% mucin in overnight grown cultures. Simultaneously, the mub gene expressed efficiently by 7 fold in the culture L. paraplantarum MTCC 9483 with 10 MUB domains. An increase in the expression levels for L. plantarum subsp. plantarum MTCC 5422 and L. plantarum subsp. argentoratensis FG16 (MCC 2974) with 9 and 8 repetitive domains was around 4 and 2 fold, respectively. The detection and expression of an integrase (int) gene in the upstream region of mub gene reveals the excision and integration of these repetitive domains. Concurrently, an in vitro adhesion assay to mucin and exclusion of pathogens (such as Listeria monocytogenes and Micrococcus leuteus) was investigated and observed that the L. paraplantarum MTCC 9483 with more adhesion domains has more ability to adhere to mucin and inhibited the growth of pathogens. The production and expression of plantaricin-like bacteriocin (plnNC8 type) in MTCC 9483 suggests the pathogen inhibition. Hence, the expression of MUB domains can act as potential biomarkers in the screening of a novel probiotic LPG strain with adherence property. The present study provides a platform for an easy, rapid, less time consuming, low-cost methodology for the detection of potential probiotic bacteria. It was known that the traditional practices followed in the preparation of fermented bamboo shoots/gundruk/cereals of Indian foods contain different kinds of neutraceuticals for functional food and novel compounds with health promoting factors. In future, a detailed study of these food products can add more nutritive value, consumption and suitable for commercialization.
105
13682
MicroRNA Expression Distinguishes Neutrophil Subtypes
Abstract:
Neutrophils are the most abundant innate immune cells to against invading microorganisms. Numerous data shown neutrophils have plasticity in response to physiological and pathological conditions. Tumor-associated neutrophils (TAN) exist in distinct types of tumor and play an important role in cancer biology. Different transcriptomic profiles of neutrophils in tumor and non-tumor samples have been identified. Several miRNAs have been recognized as regulators of gene expression in neutrophil, which may have key roles in neutrophil activation. However, the miRNAs expression patterns in TAN are not well known. To address this question, magnetic bead isolated neutrophils from tumor-bearing mice were used in this study. We analyzed production of reactive oxygen species (ROS) by luminol-dependent chemiluminescence assay. The expression of miRNAs targeting NADPH oxidase, ROS generation and autophagy was explored using quantitative real-time polymerase chain reaction. Our data suggest that tumor environment influence neutrophil develop to differential states of activation via miRNAs regulation.
104
12190
Roasting Process of Sesame Seeds Modelling Using Gene Expression Programming: A Comparative Analysis with Response Surface Methodology
Abstract:
Roasting process has the major importance to obtain desired aromatic taste of nuts. In this study, two kinds of roasting process were applied to hulled sesame seeds - vacuum oven and hot air roasting. Efficiency of Gene Expression Programming (GEP), a new soft computing technique of evolutionary algorithm that describes the cause and effect relationships in the data modelling system, and response surface methodology (RSM) were examined in the modelling of roasting processes over a range of temperature (120-180°C) for various times (30-60 min). Color attributes (L*, a*, b*, Browning Index (BI)), textural properties (hardness and fracturability) and moisture content were evaluated and modelled by RSM and GEP. The GEP-based formulations and RSM approach were compared with experimental results and evaluated according to correlation coefficients. The results showed that both GEP and RSM were found to be able to adequately learn the relation between roasting conditions and physical and textural parameters of roasted seeds. However, GEP had better prediction performance than the RSM with the high correlation coefficients (R2 >0.92) for the all quality parameters. This result indicates that the soft computing techniques have better capability for describing the physical changes occuring in sesame seeds during roasting process.
103
17923
Expression of Slit Diaphragm Genes of Chicken Embryo Mesonephros
Abstract:
Purpose: Applications of nanotechnology nowadays extended to include a wide range of scientific areas such electron micrscopy and gene expression. The aim of the current study was to investigate the developmental expression pattern of genes involved in human glomerulo-nephropathies associated with massive proteinuria and podocyte differentiation using the chicken mesonephros as a model system. Method: We performed in situ hybridization using chicken specific mRNA probes for genes expressed in the early nephron and slit diaphragm genes. The probes used were cNeph1, cNeph2, cSim1, cLmx1b, and cAtoh8. Chicken embryos from Hamburger Hamilton developmental stage HH19 (E3) to HH 34 (E9) were used for the in situ hybridization (ISH). ISH was performed on whole mount embryos which were sectioned by vibratome. Results: Our result show that Neph1, Neph2, Sim1. Lmx1b and Atoh8 genes are dynamically expressed during nephron morphogenesis and Neph1 and Atoh8 are also specifically expressed in the podocytes during late stages of differentiation. Conclusion: We conclude from our results that the genes implicated in congenital and acquired glomerulo-nephropathies like Neph1 and Neph2 are dynamically expressed during mesonephros development pointing towards a role in the formation of the filtration barrier and the differentiation of the mesonephric podocytes. Thus the avian mesonephros could serve as a model to study human kidney diseases.
102
46618
Gene Expression Signature-Based Chemical Genomic to Identify Potential Therapeutic Compounds for Colorectal Cancer
Abstract:
There is a wide range of drugs and combinations under investigation and/or approved over the last decade to treat colorectal cancer (CRC), but the 5-year survival rate remains poor at stages II–IV. Therefore, new, more efficient drugs still need to be developed that will hopefully be included in first-line therapy or overcome resistance when it appears, as part of second- or third-line treatments in the near future. In this study, we revealed that heat shock protein 90 (Hsp90) inhibitors have high therapeutic potential in CRC according to combinative analysis of NCBI's Gene Expression Omnibus (GEO) repository and chemical genomic database of Connectivity Map (CMap). We found that second generation Hsp90 inhibitor, NVP-AUY922, significantly down regulated the activities of a broad spectrum of kinases involved in regulating cell growth arrest and death of NVPAUY922-sensitive CRC cells. To overcome NVP-AUY922-induced upregulation of survivin expression which causes drug insensitivity, we found that combining berberine (BBR), a herbal medicine with potency in inhibiting survivin expression, with NVP-AUY922 resulted in synergistic antiproliferative effects for NVP-AUY922-sensitive and -insensitive CRC cells. Furthermore, we demonstrated that treatment of NVP-AUY922-insensitive CRC cells with the combination of NVP-AUY922 and BBR caused cell growth arrest through inhibiting CDK4 expression and induction of microRNA-296-5p (miR-296-5p)-mediated suppression of Pin1–β-catenin–cyclin D1 signaling pathway. Finally, we found that the expression level of Hsp90 in tumor tissues of CRC was positively correlated with CDK4 and Pin1 expression levels. Taken together, these results indicate that combination of NVP-AUY922 and BBR therapy can inhibit multiple oncogenic signaling pathways of CRC.
101
65272
Elucidation of the Sequential Transcriptional Activity in Escherichia coli Using Time-Series RNA-Seq Data
Abstract:
Functional genomics and gene regulation inference has readily expanded our knowledge and understanding of gene interactions with regards to expression regulation. With the advancement of transcriptome sequencing in time-series comes the ability to study the sequential changes of the transcriptome. This method presented here works to augment existing regulation networks accumulated in literature with transcriptome data gathered from time-series experiments to construct a sequential representation of transcription factor activity. This method is applied on a time-series RNA-Seq data set from Escherichia coli as it transitions from growth to stationary phase over five hours. Investigations are conducted on the various metabolic activities in gene regulation processes by taking advantage of the correlation between regulatory gene pairs to examine their activity on a dynamic network. Especially, the changes in metabolic activity during phase transition are analyzed with focus on the pagP gene as well as other associated transcription factors. The visualization of the sequential transcriptional activity is used to describe the change in metabolic pathway activity originating from the pagP transcription factor, phoP. The results show a shift from amino acid and nucleic acid metabolism, to energy metabolism during the transition to stationary phase in E. coli.
100
128956
Variation in Adaptation Strategies of Commelina Communis L. Biotypes under Drought Stress Condition
Abstract:
C. communis L. is an important weed of many crop, but very little information about the adaptation strategies of C. communis L. biotypes under drought stress. We investigated five biotypes of C. communis L under drought stress to identify the adaptation mechanism. The expression of drought stress related genes (DRS1, EREB and HRB1) was up-regulated in biotypes, while in some biotypes their expression was down regulated. All five biotypes can thus regulate water balance to consume less water to maintain their status under drought stress condition. This result concluded that C. communis L. biotypes can survive longer under drought stress condition. Weed scientist should seek more effective management strategies to deal with C. communis L.
99
56137
Autophagy Suppresses Tumorigenesis through Upregulation of MiR-449a in Colorectal Cancer
Abstract:
Autophagy is an essential mechanism to maintain cellular homeostasis through its degradation function, and the autophagy deficiency is related various diseases including tumorigenesis in several cancers. MicroRNAs (miRNAs) are small none coding RNAs, which regulate gene expression through degradation of mRNA or inhibition of translation. However, the relationship between autophagy deficiency and dysregulated miRNAs is still unclear. We revealed a mechanism that autophagy up-regulates miR-449a expression at the transcriptional level through activation of forkhead transcription factor family member FoxO1 and then suppresses tumorigenesis in CRC. Our data showed that the autophagic activity and miR-449a expression were lower in colorectal cancer (CRC) and has a positive correlation. We further reveal that autophagy degrades p300 expression and then suppresses acetylation of FoxO1. Under autophagic induction conditions, FoxO1 is transported from the cytoplasm to the nucleus and binds to the miR-449a promoter and then promotes miR-449a expression. In addition, either miR-449a overexpression or amiodarone-induced autophagy inhibits cell cycle progression, proliferation, colony formation migration, invasion, and tumor formation of SW480 cells. Our findings indicate that autophagy inducers may have the potential to be used for prevention and treatment of CRC through upregulation of miR-449a expression.
98
100395
Expression of Tissue Plasminogen Activator in Transgenic Tobacco Plants by Signal Peptides Targeting for Delivery to Apoplast, Endoplasmic Reticulum and Cytosol Spaces
Abstract:
Tissue plasminogen activator (tPA) as a serine protease plays an important role in the fibrinolytic system and the dissolution of fibrin clots in human body. The production of this drug in plants such as tobacco could reduce its production costs. In this study, expression of tPA gene and protein targeting to different plant cell compartments, using various signal peptides has been investigated. For high level of expression, Kozak sequence was used after CaMV35S in the beginning of the gene. In order to design the final construction, Extensin, KDEL (amino acid sequence including Lys-Asp-Glu-Leu) and SP (&gamma;-zein signal peptide coding sequence) were used as leader signals to conduct this protein into apoplast, endoplasmic reticulum and cytosol spaces, respectively. Cloned human tPA gene under the CaMV (Cauliflower mosaic virus) 35S promoter and NOS (Nopaline Synthase) terminator into pBI121 plasmid was transferred into tobacco explants by Agrobacterium tumefaciens strain LBA4404. The presence and copy number of genes in transgenic tobacco was proved by Southern blotting. Enzymatic activity of the rt-PA protein in transgenic plants compared to non-transgenic plants was confirmed by Zymography assay. The presence and amount of rt-PA recombinant protein in plants was estimated by ELISA analysis on crude protein extract of transgenic tobacco using a specific antibody. The yield of recombinant tPA in transgenic tobacco for SP, KDEL, Extensin signals were counted 0.50, 0.68, 0.69 microgram per milligram of total soluble proteins.
97
60652
Effect of Hypoxia on AOX2 Expression in Chlamydomonas reinhardtii
Abstract:
The alternative oxidase (AOX) mediates cyanide-resistant respiration, which bypasses proton-pumping complexes III and IV of the cytochrome pathway to directly transfer electrons from reduced ubiquinone to molecular oxygen. In Chlamydomonas reinhardtii, AOX is a monomeric protein that is encoded by two genes of discrete subfamilies, AOX1 and AOX2. Although AOX has been proposed to play essential roles in stress tolerance of organisms, the role of subfamily AOX2 is largely unknown. In C. reinhardtii, AOX2 was initially identified as one of constitutively low expressed genes. Like other photosynthetic organisms C. reinhardtii cells frequently experience periods of hypoxia. To examine AOX2 transcriptional regulation and role of AOX2 in hypoxia adaptation, real-time PCR analysis and artificial microRNA method were employed. Two experimental approaches have been used to induce the anoxic conditions: dark-anaerobic and light-anaerobic conditions. C. reinhardtii cells exposed to the oxygen deprivation have shown increased AOX2 mRNA levels. By contrast, AOX1 was not an anoxia-responsive gene. In C. reinhardtii, a subset of genes is regulated by transcription factor CRR1 in anaerobic conditions. Notable, the AOX2 promoter region contains the potential motif for CRR1 binding. Therefore, the role of CRR1 in the control of AOX2 transcription was tested. The CRR1-underexpressing strains, that were generated and characterized in this work, exhibited low levels of AOX2 transcripts under anoxic conditions. However, the transformants still slightly induced AOX2 gene expression in the darkness. These confirmed our suggestions that darkness is a regulatory stimulus for AOX genes in C. reinhardtii. Thus, other factors must contribute to AOX2 promoter activity under dark-anoxic conditions. Moreover, knock-down of CRR1 caused a complete reduction of AOX2 expression under light-anoxic conditions. These results indicate that (1) CRR1 is required for AOX2 expression during hypoxia, and (2) AOX2 gene is regulated by CRR1 together with yet-unknown regulatory factor(s). In addition, the AOX2-underexpressing strains were generated. The analysis of amiRNA-AOX2 strains suggested a role of this alternative oxidase in hypoxia adaptation of the alga. In conclusion, the results reported here show that C. reinhardtii AOX2 gene is stress inducible. CRR1 transcriptional factor is involved in the regulation of the AOX2 gene expression in the absence of oxygen. Moreover, AOX2 but not AOX1 functions under oxygen deprivation. This work was supported by Russian Science Foundation (research grant № 16-14-10004).
96
82733
Gene Expression Profiling of Iron-Related Genes of Pasteurella multocida Serotype A Strain PMTB2.1
Abstract:
Pasteurella multocida is associated with acute, as well as, chronic infections in avian and bovine such as pasteurellosis and hemorrhagic septicemia (HS) in cattle and buffaloes. Iron is one of the most important nutrients for pathogenic bacteria including Pasteurella and acts as a cofactor or prosthetic group in several essential enzymes and is needed for amino acid, pyrimidine, and DNA biosynthesis. In our recent study, we showed that 2% of Pasteurella multocida serotype A strain PMTB2.1 encode for iron regulating genes (Accession number CP007205.1). Genome sequencing of other Pasteurella multocida serotypes namely PM70 and HB01 also indicated up to 2.5% of the respective genome encode for iron regulating genes, suggesting that Pasteurella multocida genome comprises of multiple systems for iron uptake. Since P. multocida PMTB2.1 has more than 40 CDs out of 2097 CDs (approximately 2%), encode for iron-regulated. The gene expression profiling of four iron-regulating genes namely fbpb, yfea, fece and fur were characterized under iron-restricted environment. The P. multocida strain PMTB2.1 was grown in broth with and without iron chelating agent and samples were collected at different time points. Relative mRNA expression profile of these genes was determined using Taqman probe based real-time PCR assay. The data analysis, normalization with two house-keeping genes and the quantification of fold changes were carried out using Bio-Rad CFX manager software version 3.1. Results of this study reflect that iron reduced environment has significant effect on expression profile of iron regulating genes (p < 0.05) when compared to control (normal broth) and all evaluated genes act differently with response to iron reduction in media. The highest relative fold change of fece gene was observed at early stage of treatment indicating that PMTB2.1 may utilize its periplasmic protein at early stage to acquire iron. Furthermore, down-regulation expression of fece with the elevated expression of other genes at later time points suggests that PMTB2.1 control their iron requirements in response to iron availability by down-regulating the expression of iron proteins. Moreover, significantly high relative fold change (p ≤ 0.05) of fbpb gene is probably associated with the ability of P. multocida to directly use host iron complex such as hem, hemoglobin. In addition, the significant increase (p ≤ 0.05) in fbpb and yfea expressions also reflects the utilization of multiple iron systems in P. multocida strain PMTB2.1. The findings of this study are very much important as relative scarcity of free iron within hosts creates a major barrier to microbial growth inside host and utilization of outer-membrane proteins system in iron acquisition probably occurred at early stage of infection with P. multocida. In conclusion, the presence and utilization of multiple iron system in P. multocida strain PMTB2.1 revealed the importance of iron in the survival of P. multocida.
95
94598
Silica Nanoparticles Induced Oxidative Stress and Inflammation in MRC-5 Human Lung Fibroblasts
Abstract:
Silica nanoparticles (SiO2-NPs) are widely used in consumer products such as paints, plastics, insulation materials, tires, concrete production, as well as in gene delivery systems and imaging procedures. Environmental human exposure to them occurs during utilization of these products, in a time-dependent manner, the uptake being by topic and inhalation route especially. SiO2-NPs enter cells and induce membrane damage, oxidative stress and inflammatory reactions in a concentration-dependent manner. In this study, MRC-5 cells (human fetal lung fibroblasts) were exposed to amorphous SiO2-NPs at a dose of 62.5 μg/ml for 24, 48 and 72 hours. The size distribution of NPs was a lognormal function, in the range 3-14 nm. A time-dependent decrease of total reduced glutathione concentration by 36%, 50%, and 78% and an increase of NO level by 62%, 32%, respectively 24% compared to control were noticed. An up-regulation of NF-kB expression by 20%, 50% respectively 10% and of Nrf-2 by 139%, 58%, and 16% compared to control after 24, 48 and 72 hours was noticed also. The expression of IL-1β, IL-6, IL-8, and COX-2 was up-regulated in a time-dependent manner. Also, the expression of MMP-2 and MMP-9 were down-regulated after 48 and 72 hours, whereas their activities raised in a time-dependent manner. Exposure of cells to NPs up-regulated the expression of inducible NO synthase, as previously was shown, and probably this is the reason for the increased level of NO, that can react with the thiol groups of reduced glutathione molecules, diminishing its concentration Nrf2 is a transcription factor translocated in nucleus, under oxidative stress, where downstream gene expression activates in order to modulate the adaptive intracellular response against oxidative stress. The cross-talk between Nrf2 and NF-kB activities regulates the inflammatory processes. The activation of NF-kB could activate up-regulation of IL-1β, IL-6, and IL-8. The increase of COX-2 expression could be correlated with IL-1β one. Also, probably in response to the pro-inflammatory cytokines, MMP-2 and MMP-9 were induced and activated. In conclusion, the exposure of MRC-5 cells to SiO2-NPs generated inflammation in a time-dependent manner.
94
39156
CanVis: Towards a Web Platform for Cancer Progression Tree Analysis
Abstract:
Cancer is a major public health problem all over the world. Breast cancer has the highest incidence rate over all cancers for women in Qatar making its study a top priority of the country. Human cancer is a dynamic disease that develops over an extended period through the accumulation of a series of genetic alterations. A Darwinian process drives the tumor cells toward higher malignancy growing the branches of a progression tree in the space of genes expression. Although it is not possible to track these genetic alterations dynamically for one patient, it is possible to reconstruct the progression tree from the aggregation of thousands of tumor cells’ genetic profiles from thousands of different patients at different stages of the disease. Analyzing the progression tree is a way to detect pivotal molecular events that drive the malignant evolution and to provide a guide for the development of cancer diagnostics, prognostics and targeted therapeutics. In this work we present the development of a Visual Analytic web platform CanVis enabling users to upload gene-expression data and analyze their progression tree. The server computes the progression tree based on state-of-the-art techniques and allows an interactive visual exploration of this tree and the gene-expression data along its branching structure helping to discover potential driver genes.
93
15750
Integration of Microarray Data into a Genome-Scale Metabolic Model to Study Flux Distribution after Gene Knockout
Abstract:
Prediction of perturbations after genetic manipulation (especially gene knockout) is one of the important challenges in systems biology. In this paper, a new algorithm is introduced that integrates microarray data into the metabolic model. The algorithm was used to study the change in the cell phenotype after knockout of Gss gene in Escherichia coli BW25113. Algorithm implementation indicated that gene deletion resulted in more activation of the metabolic network. Growth yield was more and less regulating gene were identified for mutant in comparison with the wild-type strain.
92
94346
Circadian Expression of MicroRNAs in Colon and Its Changes during Colorectal Tumorigenesis
Abstract:
MicroRNAs are small non-coding RNAs involved in a wide range of physiological processes. Post-transcriptional regulation of gene expression by microRNAs gives the organism a further level of control of the gene-expression program and the disruption of this microRNA regulatory mechanism seems to increase the risk of various pathophysiological conditions including tumorigenesis. To the present day, microRNAs were shown to participate in the mayor signalization pathways leading to tumorigenesis, including proliferation, cell cycle, apoptosis and metastasis formation. In addition, microRNAs have been found to play important roles in the generation and maintenance of circadian clock. These clocks generate circadian rhythms, which participate in a number of regulatory pathways. Disruption of the circadian signals seems to be associated with the development and the progression of tumours including colorectal cancer. We investigated therefore whether the diurnal profiles of miRNAs linked to tumorigenesis and regulation of circadian clock are changed during tumorigenesis. Based on published data we chose 10 microRNAs linked to tumorigenesis or circadian clock (let-7b-5p, miR 1 3p, miR 106b 5p, miR 141 3p, miR 191 5p, miR 20a 5p, miR 25 3p, miR 29a 3p, miR 34a 5p and miR 93 5p) and compared their 24-hr expression profiles in healthy and in chemically induces primary colorectal tumours of 52week-old mice. Using RT-qPCR we proved circadian rhythmicity in let-7b-5p, miR 106b 5p, miR 141 3p, miR 191 5p, miR 20a 5p, miR 25 3p, miR 29a 3p and miR 93 5p in healthy colon but not in tumours. The acrophases of miR 106b 5p, miR 141 3p, miR 191 5p, miR 20a 5p, miR 25 3p and miR 93 5p were reached around CT 24, the acrophases of let-7b-5p and miR-29a-3p were slightly shifted and reached around CT 21. In summary, our results show that circadian regulation of some colonic microRNAs is greatly affected by neoplastic transformation.
91
40375
Effect of Leptin Gene Methylation on Colorectal Cancer Chemoresistance
Abstract:
Colorectal cancer (CRC) is one of the most common tumors all over the world. Obesity, considered a risk factor of CRC, is characterized by a high level of secreted cytokines from adipose tissue. Among these inflammatory molecules, leptin is considered the key mediator for CRC cancer development and progression by activation of mitogenic and anti apoptotic signaling pathways. Gene expression can be significantly modulated by alterations in DNA methylation patterns. The aim of this study is to investigate the impact of leptin gene methylation on CRC prognosis and sensitivity to chemotherapy. The study involved 70 CRC tissue samples collected from King Abdullah University Hospital (KAUH) from which only 53 was analyzed because of bisulfate fragmentation and low yield of DNA extracted from FFPE tissues. A total of 22 blood samples were collected from healthy volunteers and enrolled as a control group. Leptin promoter methylation was analyzed by methylation specific PCR after bisulfate conversion. Results revealed that the incidence of leptin gene methylation was significantly higher in CRC patients in comparison to that of controls (P < 0.05). The correlation between patient’s demographics and leptin gene methylation was not significant (P < 0.05). However, a significant correlation between leptin gene methylation status and early cancer stages (I, II and III) was found in male but not in female (p < 0.05). Moreover, a significant correlation was found between leptin promoter methylation and early tumor localization T1-2 (p < 0.05). The correlation between epigenetic regulation of leptin and chemosensitivity was not significant. Taken together, these results suggest the possibility to use leptin gene methylation as a biomarker for the evaluation of CRC prognosis and metastasis.
90
40812
Following the Modulation of Transcriptional Activity of Genes by Chromatin Modifications during the Cell Cycle in Living Cells
Abstract:
Understanding the dynamics of transcription in living cells has improved since the development of quantitative fluorescence-based imaging techniques. We established a method for following transcription from a single copy gene in living cells. A gene tagged with MS2 repeats, used for mRNA tagging, in its 3' UTR was integrated into a single genomic locus. The actively transcribing gene was detected and analyzed by fluorescence in situ hybridization (FISH) and live-cell imaging. Several cell clones were created that differed in the promoter regulating the gene. Thus, comparative analysis could be obtained without the risk of different position effects at each integration site. Cells in S/G2 phases could be detected exhibiting two adjacent transcription sites on sister chromatids. A sharp reduction in the transcription levels was observed as cells progressed along the cell cycle. We hypothesized that a change in chromatin structure acts as a general mechanism during the cell cycle leading to down-regulation in the activity of some genes. We addressed this question by treating the cells with chromatin decondensing agents. Quantifying and imaging the treated cells suggests that chromatin structure plays a role both in regulating transcriptional levels along the cell cycle, as well as in limiting an active gene from reaching its maximum transcription potential at any given time. These results contribute to understanding the role of chromatin as a regulator of gene expression.
89
37920
Nonlinear Observer Canonical Form for Genetic Regulation Process
Abstract:
This paper aims to study the existence of the change of coordinates which permits to transform a class of nonlinear dynamical systems into the so-called nonlinear observer canonical form (NOCF). Moreover, an algorithm to construct such a change of coordinates is given. Based on this form, we can design an observer with a linear error dynamic. This enables us to estimate the state of a nonlinear dynamical system. A concrete example (biological model) is provided to illustrate the feasibility of the proposed results.
88
79896
PARP1 Links Transcription of a Subset of RBL2-Dependent Genes with Cell Cycle Progression
Abstract:
Apart from protecting genome, PARP1 has been documented to regulate many intracellular processes inter alia gene transcription by physically interacting with chromatin bound proteins and by their ADP-ribosylation. Our recent findings indicate that expression of PARP1 decreases during the differentiation of human CD34+ hematopoietic stem cells to monocytes as a consequence of differentiation-associated cell growth arrest and formation of E2F4-RBL2-HDAC1-SWI/SNF repressive complex at the promoter of this gene. Since the RBL2 complexes repress genes in a E2F-dependent manner and are widespread in the genome in G0 arrested cells, we asked (a) if RBL2 directly contributes to defining monocyte phenotype and function by targeting gene promoters and (b) if RBL2 controls gene transcription indirectly by repressing PARP1. For identification of genes controlled by RBL2 and/or PARP1,we used primer libraries for surface receptors and TLR signaling mediators, genes were silenced by siRNA or shRNA, analysis of gene promoter occupation by selected proteins was carried out by ChIP-qPCR, while statistical analysis in GraphPad Prism 5 and STATISTICA, ChIP-Seq data were analysed in Galaxy 2.5.0.0. On the list of 28 genes regulated by RBL2, we identified only four solely repressed by RBL2-E2F4-HDAC1-BRM complex. Surprisingly, 24 out of 28 emerged genes controlled by RBL2 were co-regulated by PARP1 in six different manners. In one mode of RBL2/PARP1 co-operation, represented by MAP2K6 and MAPK3, PARP1 was found to associate with gene promoters upon RBL2 silencing, which was previously shown to restore PARP1 expression in monocytes. PARP1 effect on gene transcription was observed only in the presence of active EP300, which acetylated gene promoters and activated transcription. Further analysis revealed that PARP1 binding to MA2K6 and MAPK3 promoters enabled recruitment of EP300 in monocytes, while in proliferating cancer cell lines, which actively transcribe PARP1, this protein maintained EP300 at the promoters of MA2K6 and MAPK3. Genome-wide analysis revealed a similar distribution of PARP1 and EP300 around transcription start sites and the co-occupancy of some gene promoters by PARP1 and EP300 in cancer cells. Here, we described a new RBL2/PARP1/EP300 axis which controls gene transcription regardless of the cell type. In this model cell, cycle-dependent transcription of PARP1 regulates expression of some genes repressed by RBL2 upon cell cycle limitation. Thus, RBL2 may indirectly regulate transcription of some genes by controlling the expression of EP300-recruiting PARP1. Acknowledgement: This work was financed by Polish National Science Centre grants nr DEC-2013/11/D/NZ2/00033 and DEC-2015/19/N/NZ2/01735. L.V. is funded by the National Research, Development and Innovation Office grants GINOP-2.3.2-15-2016-00020 TUMORDNS, GINOP-2.3.2-15-2016-00048-STAYALIVE and OTKA K112336. AR is supported by Polish Ministry of Science and Higher Education 776/STYP/11/2016.
87
2900
Sesamol Decreases Melanin Biosynthesis via Melanogenesis-Related Gene Expressions in Melan-a Cells
Abstract:
The development of anti-melanogenic agents is important for the prevention of serious esthetic problem like a melasma, freckle, age spots, and chloasma. The aim of this study was to investigate the anti-melanogenic effect of sesamol, an active lignan isolated from sesame seed, by mushroom and cellular tyrosinase assay, melanin content and the analysis of melanogensis-related mRNA expressions in melana cells. Sesamol showed strong inhibitory activity against the mushroom tyrosinase in a dose-dependent manner. Intracellular tyrosinase inhibition activity was also confirmed by zymography. At a concentration of 50 μM, sesamol inhibited melanin production in melan-a cells with no cytoxicity while those of phenylthiourea (PTU) as a positive control were the same condition. Sesamol significantly inhibited the expression of melanogensis-related genes, such as tyrosinase, tyrosinase-related protein-1 (TRP-1), dopachrome tautomerase (Dct), microphthalmia-associated transcription factor (MITF) and melanocortin 1 receptor (MC1R). These findings indicate that sesamol could reduce melanin biosynthesis via the downregulation of tyrosinase activity and melanin production via subsequent gene expression of melanogenesis-related proteins. Together, these results suggest that the sesamol have strong potential in inhibiting melanin biosynthesis, in that the substance may be used as a new skin-whitening agent of cosmetic materials.
86
45510
Altered Expression of Ubiquitin Editing Complex in Ulcerative Colitis
Abstract:
Introduction: Ulcerative Colitis (UC) is an inflammatory disease of the colon resulting from an autoimmune response towards individual’s own microbiota. Excessive inflammation is characterized by hyper-activation of NFkB, a transcription factor regulating expression of various pro-inflammatory genes. The ubiquitin editing complex consisting of TNFAIP3, ITCH, RNF11 and TAX1BP1 maintains homeostatic levels of active NFkB through feedback inhibition and assembles in response to various stimuli that activate NFkB. TNFAIP3 deubiquitinates key signaling molecules involved in NFkB activation pathway. ITCH, RNF11 and TAX1BP1 provide substrate specificity, acting as adaptors for TNFAIP3 function. Aim: This study aimed to find expression of members of the ubiquitin editing complex at the transcript level in inflamed colon tissues of UC patients. Materials and Methods: Colonic biopsy samples were collected from 30 UC patients recruited at Department of Gastroenterology, AIIMS (New Delhi). Control group (n= 10) consisted of individuals undergoing examination for functional disorders. Real Time PCR was used to determine relative expression with GAPDH as housekeeping gene. Results: Expression of members of the ubiquitin editing complex was significantly altered during active disease. Expression of TNFAIP3 was upregulated while concomitant decrease in expression of ITCH, RNF11, TAX1BP1 was seen in UC patients. Discussion: This study reveals that increase in expression of TNFAIP3 was unable to control inflammation during active UC. Further, insufficient upregulation of ITCH, RNF11, TAX1BP1 may limit the formation of the ubiquitin complex and contribute to pathogenesis of UC.
85
108802
The Interplay between Autophagy and Macrophages' Polarization in Wound Healing: A Genetic Regulatory Network Analysis
Abstract:
Background: Autophagy is a eukaryotic, highly conserved catabolic process implicated in many pathophysiologies such as wound healing. Autophagy-associated genes serve as a scaffolding platform for signal transduction of macrophage polarization during the inflammatory phase of wound healing and tissue repair process. In the current study, we report a model for the interplay between autophagy-associated genes and macrophages polarization associated genes. Methods: In silico analysis was performed on 249 autophagy-related genes retrieved from the public autophagy database and gene expression data retrieved from Gene Expression Omnibus (GEO); GSE81922 and GSE69607 microarray data macrophages polarization 199 DEGS. An integrated protein-protein interaction network was constructed for autophagy and macrophage gene sets. The gene sets were then used for GO terms pathway enrichment analysis. Common transcription factors for autophagy and macrophages' polarization were identified. Finally, microRNAs enriched in both autophagy and macrophages were predicated. Results: In silico prediction of common transcription factors in DEGs macrophages and autophagy gene sets revealed a new role for the transcription factors, HOMEZ, GABPA, ELK1 and REL, that commonly regulate macrophages associated genes: IL6,IL1M, IL1B, NOS1, SOC3 and autophagy-related genes: Atg12, Rictor, Rb1cc1, Gaparab1, Atg16l1. Conclusions: Autophagy and macrophages' polarization are interdependent cellular processes, and both autophagy-related proteins and macrophages' polarization related proteins coordinate in tissue remodelling via transcription factors and microRNAs regulatory network. The current work highlights a potential new role for transcription factors HOMEZ, GABPA, ELK1 and REL in wound healing.
84
16079
C-eXpress: A Web-Based Analysis Platform for Comparative Functional Genomics and Proteomics in Human Cancer Cell Line, NCI-60 as an Example
Abstract:
Background: Recent advances in high-throughput research technologies such as new-generation sequencing and multi-dimensional liquid chromatography makes it possible to dissect the complete transcriptome and proteome in a single run for the first time. However, it is almost impossible for many laboratories to handle and analysis these “BIG” data without the support from a bioinformatics team. We aimed to provide a web-based analysis platform for users with only limited knowledge on bio-computing to study the functional genomics and proteomics. Method: We use NCI-60 as an example dataset to demonstrate the power of the web-based analysis platform and data delivering system: C-eXpress takes a simple text file that contain the standard NCBI gene or protein ID and expression levels (rpkm or fold) as input file to generate a distribution map of gene/protein expression levels in a heatmap diagram organized by color gradients. The diagram is hyper-linked to a dynamic html table that allows the users to filter the datasets based on various gene features. A dynamic summary chart is generated automatically after each filtering process. Results: We implemented an integrated database that contain pre-defined annotations such as gene/protein properties (ID, name, length, MW, pI); pathways based on KEGG and GO biological process; subcellular localization based on GO cellular component; functional classification based on GO molecular function, kinase, peptidase and transporter. Multiple ways of sorting of column and rows is also provided for comparative analysis and visualization of multiple samples.
83
84557
Up-Regulation of SCUBE2 Expression in Co-Cultures of Human Mesenchymal Stem Cell and Breast Cancer Cells
Abstract:
Stem cell has been known for its potency to be differentiated in many cells. Recently stem cell has been used for many treatment of degenerative medicine. It is still controversy whether stem cell can be used for therapy or these cells can activate cancer stem cell. SCUBE2 is a novel secreted and membrane-anchored protein which has been reported to its role in better prognosis and inhibition of cancer cell proliferation. Our study aims to observe whether stem cell can up-regulate SCUBE2 gene in MCF7 breast cancer cell line. We used in vitro study using MCF-7 cell treated with stem cell derived from placenta Wharton's jelly which has been known for its stemness and widely used. Our results showed that MCF-7 cell line grows up rapidly in 6-well culture dish. Stem cell was cultured in 6-well dish. After 50%-60% MCF-7 confluence, we co-cultured these cells with stem cells for 24 hours and 48 hours. We hypothesize SCUBE2 gene which is previously known for its higher expression in better prognosis of breast cancer, is up-regulated after stem cells addition in MCF7 culture dishes.
82
41062
Protection and Immune Responses of DNA Vaccines Targeting Virulence Factors of Streptococcus iniae in Nile Tilapia (Oreochromis niloticus)
Abstract:
Streptococcus iniae (SI) is a devastating pathogenic bacteria causing heavy mortality in farmed fish. The application of commercialized bacterin vaccine has been reported failures as the outbreaks of the new serotype of SI were emerged in farms after vaccination and subsequently caused severe losses. In the present study, we attempted to develop effective DNA vaccines against SI infection using Nile tilapia (Oreochromis niloticus) as an animal model. Two monovalent DNA vaccines were constructed by the insertion of coding sequences of cell wall-associated virulence factors-encoding genes, comprised of eno (α-enolase) and mtsB (hydrophobic membrane protein), into cytomegalovirus expression vector (pCI-neo). In the animal trial, 30-g Nile tilapia were injected intramuscularly with 15 µg of each vaccine (mock vaccine group was injected by naked pCI-neo) and maintained for 35 days prior challenging with pathogenic SI at the dosage of 107 CFU/fish. At 13 days post-challenge, the relative percent survival of pEno, pMtsB and mock vaccine were 57%, 45% and 27%, respectively. The expression levels of immune responses-associated genes, namely, IL1β, TNF-α, TGF-β, COX2, IL-6, IL-12 and IL-13, were investigated from the spleen of experimental animal at 7 days post-vaccination (PV) and 7 days post-challenge (PC) using quantitative RT-PCR technique. Generally, at 7 days PV, the pEno vaccinated group exhibited highest level of up-regulation (1.7 to 2.9 folds) of every gene, but TGF-β, comparing to pMtsB and mock vaccine groups. However, at 7 days PC, pEno group showed significant up-regulation (1.4 to 8.5 folds) of immune-related genes as similar as mock vaccine group, while pMtsB group had lowest level of up-regulation (0.7 to 3.3 folds). Summarily, this study indicated that the pEno and pMtsB vaccines could elicit the immune responses of the fish and the magnitude of gene expression at 7 days PV was also consistent with the protection level conferred by the vaccine.
81
41708
Hsa-miR-139-5p Acts as a Tumor Suppressor by Targeting C-Met in Non-Small Cell Lung Cancer
Abstract:
Hsa-miRNA-139-5p (miR-139-5p) has recently been discovered having anticancer efficacy in different organs. However, the role of miR-139-5p on lung cancer is still ambiguous. In this study, we investigated the role of miR-139-5p on development of lung cancer. Results indicated miR-139-5p was significantly down-regulated in primary tumor tissues and very low levels were found in a non-small cell lung cancer (NSCLC) cell lines. Ectopic expression of miR-139-5p in NSCLC cell lines significantly suppressed cell growth through inhibition of cyclin D1 and up-regulation of p57(Kip2). In addition, miR-139-5p induced apoptosis, as indicated by up-regulation of key apoptosis gene cleaved caspase-3, and down-regulation of anti-apoptosis gene Bcl2. Moreover, miR-139-5p inhibited cellular metastasis through inhibition of matrix metalloproteinases (MMP)-7 and MMP-9. Further, oncogene c-Met was revealed to be a putative target of miR-139-5p, which was inversely correlated with miR-139-5p expression. Taken together, our results demonstrated that miR-139-5p plays a pivotal role in lung cancer through inhibiting cell proliferation, metastasis, and promoting apoptosis by targeting oncogenic c-Met.
80
41379
Hsa-miR-329 Functions as a Tumor Suppressor through Targeting MET in Non-Small Cell Lung Cancer
Abstract:
MicroRNAs (miRNAs) act as key regulators of multiple cancers. Hsa-miR-329 (miR-329) functions as a tumor suppressor in some malignancies. However, its role on lung cancer remains poorly understood. In this study, we investigated the role of miR-329 on the development of lung cancer. The results indicated that miR-329 was decreased in primary lung cancer tissues compared with matched adjacent normal lung tissues and very low levels were found in a non-small cell lung cancer (NSCLC) cell lines. Ectopic expression of miR-329 in lung cancer cell lines substantially repressed cell growth as evidenced by cell viability assay, colony formation assay and BrdU staining, through inhibiting cyclin D1, cyclin D2, and up-regulatiing p57(Kip2) and p21(WAF1/CIP1). In addition, miR-329 promoted NSCLC cell apoptosis, as indicated by up-regulation of key apoptosis gene cleaved caspase-3, and down-regulation of anti-apoptosis gene Bcl2. Moreover, miR-329 inhibited cellular migration and invasiveness through inhibiting matrix metalloproteinases (MMP)-7 and MMP-9. Further, oncogene MET was revealed to be a putative target of miR-329, which was inversely correlated with miR-329 expression. Furthermore, down-regulation of MET by siRNA performed similar effects to over-expression of miR-329. Collectively, our results demonstrated that miR-329 played a pivotal role in lung cancer through inhibiting cell proliferation, migration, invasion, and promoting apoptosis by targeting oncogenic MET.
79
62224
Evaluation of the Spatial Regulation of Hydrogen Sulphide Producing Enzymes in the Placenta during Labour
Abstract:
Background: Labour in human is a complex biological process that involves interactions of neurological, hormonal and inflammatory pathways, with the placenta being a key regulator of these pathways. It is known that uterine contractions and labour pain cause physiological changes in gene expression in maternal and fetal blood, and in placenta during labour. Oxidative and inflammatory stress pathways are implicated in labour and they may cause alteration of placental gene expression. Additionally, in placental tissues, labour increases the expression of genes involved in placental oxidative stress, inflammatory cytokines, angiogenic regulators and apoptosis. Recently, Hydrogen Sulphide (H2S) has been considered as an endogenous gaseous mediator which promotes vasodilation and exhibits cytoprotective anti-inflammatory properties. The endogenous H2S is synthesised predominantly by two enzymes: cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE). As the H2S pathway has anti-oxidative and anti-inflammatory characteristics thus, we hypothesised that the expression of CBS and CSE in placental tissues would alter during labour. Methods: CBS and CSE expressions were examined in placentas using western blotting and RT-PCR in inner, middle and outer placental zones in placentas obtained from healthy non labouring women who delivered by caesarian section. These were compared with the equivalent zone of placentas obtained from women who had uncomplicated labour and delivered vaginally. Results: No differences in CBS and CSE mRNA or protein levels were found between the different sites within placentas in either the labour or non-labour group. There were no significant differences in either CBS or CSE expression between the two groups at the inner site and middle site. However, at the outer site there was a highly significant decrease in CBS protein expression in the labour group when compared to the non-labour group (p = 0.002). Conclusion: To the best of author’s knowledge, this is the first report to suggest that, CBS is expressed in a spatial manner within the human placenta. Further work is needed to clarify the precise function and mechanism of this spatial regulation although it is likely that inflammatory pathways regulation is a complex process in which this plays a role.
78
99030
Inhibition of Variant Surface Glycoproteins Translation to Define the Essential Features of the Variant Surface Glycoprotein in Trypanosoma brucei
Abstract:
Trypanosoma brucei, the causal agent of a range of diseases in humans and livestock, evades the mammalian immune system through a population survival strategy based on the expression of a series of antigenically distinct variant surface glycoproteins (VSGs). RNAi mediated knockdown of the active VSG gene triggers a precytokinesis cell cycle arrest. To determine whether this phenotype is the result of reduced VSG transcript or depleted VSG protein, we used morpholino antisense oligonucleotides to block translation of VSG mRNA. The same precytokinesis cell cycle arrest was observed, suggesting that VSG protein abundance is monitored closely throughout the cell cycle. An inducible expression system has been developed to test various GPI-anchored proteins for their ability to rescue this cell cycle arrest. This system has been used to demonstrate that wild-type VSG expressed from a T7 promoter rescues this phenotype. This indicates that VSG expression from one of the specialised bloodstream expression sites (BES) is not essential for cell division. The same approach has been used to define the minimum essential features of a VSG necessary for function.
77
73820
The Bicoid Gradient in the Drosophila Embryo: 3D Modelling with Realistic Egg Geometries
Abstract:
Segmentation of the early Drosophila embryo results from the dynamic establishment of spatial gene expression patterns. Patterning occurs on an embryo geometry which is a 'deformed' prolate ellipsoid, with anteroposterior and dorsal-ventral major and minor axes, respectively. Patterning is largely independent along each axis, but some interaction can be seen in the 'bending' of the segmental expression stripes. This interaction is not well understood. In this report, we investigate how 3D geometrical features of the early embryo affect the segmental expression patterning. Specifically, we study the effect of geometry on formation of the Bicoid primary morphogenetic gradient. Our computational results demonstrate that embryos with a much longer ventral than dorsal surface ('bellied') can produce curved Bicoid concentration contours which could activate curved stripes in the downstream pair-rule segmentation genes. In addition, we show that having an extended source for Bicoid in the anterior of the embryo may be necessary for producing the observed exponential form of the Bicoid gradient along the anteroposterior axis.
76
18210
Comparative Study on Daily Discharge Estimation of Soolegan River
Abstract:
Hydrological modeling in arid and semi-arid regions is very important. Iran has many regions with these climate conditions such as Chaharmahal and Bakhtiari province that needs lots of attention with an appropriate management. Forecasting of hydrological parameters and estimation of hydrological events of catchments, provide important information that used for design, management and operation of water resources such as river systems, and dams, widely. Discharge in rivers is one of these parameters. This study presents the application and comparison of some estimation methods such as Feed-Forward Back Propagation Neural Network (FFBPNN), Multi Linear Regression (MLR), Gene Expression Programming (GEP) and Bayesian Network (BN) to predict the daily flow discharge of the Soolegan River, located at Chaharmahal and Bakhtiari province, in Iran. In this study, Soolegan, station was considered. This Station is located in Soolegan River at 51° 14՜ Latitude 31° 38՜ longitude at North Karoon basin. The Soolegan station is 2086 meters higher than sea level. The data used in this study are daily discharge and daily precipitation of Soolegan station. Feed Forward Back Propagation Neural Network(FFBPNN), Multi Linear Regression (MLR), Gene Expression Programming (GEP) and Bayesian Network (BN) models were developed using the same input parameters for Soolegan's daily discharge estimation. The results of estimation models were compared with observed discharge values to evaluate performance of the developed models. Results of all methods were compared and shown in tables and charts.
75
36807
High Level Expression of Fluorinase in Escherichia Coli and Pichia Pastoris
Abstract:
The first fluorinating enzyme, 5'-fluoro-5'-deoxyadenosine synthase (fluorinase) was isolated from the soil bacterium Streptomyces cattleya. Such an enzyme, with the ability to catalyze a C-F bond, presents great potential as a biocatalyst. Naturally fluorinated compounds are extremely rare in nature. As a result, the number of fluorinases identified remains relatively few. The field of fluorination is almost completely synthetic. However, with the increasing demand for fluorinated organic compounds of commercial value in the agrochemical, pharmaceutical and materials industries, it has become necessary to utilize biologically based methods such as biocatalysts. A key step in this crucial process is the large-scale production of the fluorinase enzyme in considerable quantities for industrial applications. Thus, this study aimed to optimize expression of the fluorinase enzyme in both prokaryotic and eukaryotic expression systems in order to obtain high protein yields. The fluorinase gene was cloned into the pET 41b(+) and pPinkα-HC vectors and used to transform the expression hosts, E.coli BL21(DE3) and Pichia pastoris (PichiaPink™ strains) respectively. Expression trials were conducted to select optimal conditions for expression in both expression systems. Fluorinase catalyses a reaction between S-adenosyl-L-Methionine (SAM) and fluoride ion to produce 5'-fluorodeoxyadenosine (5'FDA) and L-Methionine. The activity of the enzyme was determined using HPLC by measuring the product of the reaction 5'FDA. A gradient mobile phase of 95:5 v/v 50mM potassium phosphate buffer to a final mobile phase containing 80:20 v/v 50mM potassium phosphate buffer and acetonitrile were used. This resulted in the complete separation of SAM and 5’-FDA which eluted at 1.3 minutes and 3.4 minutes respectively. This proved that the fluorinase enzyme was active. Optimising expression of the fluorinase enzyme was successful in both E.coli and PichiaPink™ where high expression levels in both expression systems were achieved. Protein production will be scaled up in PichiaPink™ using fermentation to achieve large-scale protein production. High level expression of protein is essential in biocatalysis for the availability of enzymes for industrial applications.
74
79138
In vitro Study of Inflammatory Gene Expression Suppression of Strawberry and Blackberry Extracts
Abstract:
The physiology of various inflammatory diseases is a complex process mediated by inflammatory and immune cells such as macrophages and monocytes. Chronic inflammation, as observed in many cardiovascular and autoimmune disorders, occurs when the low-grade inflammatory response fails to resolve with time. Because of the complexity of the chronic inflammatory disease, major efforts have focused on identifying novel anti-inflammatory agents and dietary regimes that prevent the pro-inflammatory process at the early stage of gene expression of key pro-inflammatory mediators and cytokines. The ability of the extracts of three blackberry cultivars (‘Jumbo’, ‘Black Satin’ and ‘Dirksen’), and one strawberry cultivar (‘Camarosa’) to inhibit four well-known genetic biomarkers of inflammation: inducible nitric oxide synthase (iNOS), cyclooxynase-2 (Cox-2), interleukin-1β (IL-1β) and interleukin-6 (IL-6) in an in vitro lipopolysaccharide-stimulated murine RAW 264.7 macrophage model were investigated. Moreover, the effect of latter extracts on the intracellular reactive oxygen species (ROS) and nitric oxide (NO) production was assessed. Assay was conducted with 50 µg/mL crude extract concentration, an amount that is easily achievable in the gastrointestinal tract after berries consumption. The mRNA expression levels of Cox-2 and IL-6 were reduced consistently (more than 30%) by extracts of ‘Jumbo’ and ‘Black Satin’ blackberries. Strawberry extracts showed high reduction in mRNA expression levels of IL-6 (more than 65%) and exhibited moderate reduction in mRNA expression of Cox-2 (more than 35%). The latter behavior mirrors the intracellular ROS production of the LPS stimulated RAW 264.7 macrophages after the treatment with blackberry ‘Black Satin’ and ‘Jumbo’, and strawberry ‘Camarosa’ extracts, suggesting that phytochemicals from these fruits may play a role in the health maintenance by reducing oxidative stress. On the other hand, effective inhibition in the gene expression of IL-1β and iNOS was not observed by any of blackberry and strawberry extracts. However, suppression in the NO production in the activated macrophages among 5–25% was observed by ‘Jumbo’ and ‘Black Satin’ blackberry extracts and ‘Camarosa’ strawberry extracts, suggesting a higher NO suppression property by phytochemicals of these fruits. All these results suggest the potential beneficial effects of studied berries as functional foods with antioxidant and anti-inflammatory roles. Moreover, the underlying role of phytochemicals from these fruits in the protection of inflammatory process will deserve to be further explored.
73
103181
Unzipping the Stress Response Genes in Moringa oleifera Lam. through Transcriptomics
Abstract:
Moringa oleifera Lam. is known mainly for its high nutritional value and medicinal properties contributing to its popular reputation as a 'miracle plant' in the tropical climates where it usually grows. The main objective of this study is to discover the genes and gene products involved in abiotic stress-induced activity that may impact the M. oleifera Lam. mature seeds as well as their corresponding functions. In this study, RNA-sequencing and de novo transcriptome assembly were performed using two assemblers, Trinity and Oases, which produced 177,417 and 120,818 contigs respectively. These transcripts were then subjected to various bioinformatics tools such as Blast2GO, UniProt, KEGG, and COG for gene annotation and the analysis of relevant metabolic pathways. Furthermore, FPKM analysis was performed to identify gene expression levels. The sequences were filtered according to the 'response to stress' GO term since this study dealt with stress response. Clustered Orthologous Groups (COG) showed that the highest frequencies of stress response gene functions were those of cytoskeleton which make up approximately 14% and 23% of stress-related sequences under Trinity and Oases respectively, recombination, repair and replication at 11% and 14% respectively, carbohydrate transport and metabolism at 23% and 9% respectively and defense mechanisms 16% and 12% respectively. KEGG pathway analysis determined the most abundant stress-response genes in the phenylpropanoid biosynthesis at counts of 187 and 166 pathways for Oases and Trinity respectively, purine metabolism at 123 and 230 pathways, and biosynthesis of antibiotics at 105 and 102. Unique and cumulative GO term counts revealed that majority of the stress response genes belonged to the category of cellular response to stress at cumulative counts of 1,487 to 2,187 for Oases and Trinity respectively, defense response at 754 and 1,255, and response to heat at 213 and 208, response to water deprivation at 229 and 228, and oxidative stress at 508 and 488. Lastly, FPKM was used to determine the levels of expression of each stress response gene. The most upregulated gene encodes for thiamine thiazole synthase chloroplastic-like enzyme which plays a significant role in DNA damage tolerance. Data analysis implies that M. oleifera stress response genes are directed towards the effects of climate change more than other stresses indicating the potential of M. oleifera for cultivation in harsh environments because it is resistant to climate change, pathogens, and foreign invaders.
72
24401
Supplementation of Annatto (Bixa orellana)-Derived δ-Tocotrienol Produced High Number of Morula through Increased Expression of 3-Phosphoinositide-Dependent Protein Kinase-1 (PDK1) in Mice
Abstract:
Several embryonic cellular mechanism including cell cycle, growth and apoptosis are regulated by phosphatidylinositol-3-kinase (PI3K)/Akt signaling pathway. The goal of present study is to determine the effects of annatto (Bixa orellana)-derived δ-tocotrienol (δ-TCT) on the regulations of PI3K/Akt genes in murine morula. Twenty four 6-8 week old (23-25g) female balb/c mice were randomly divided into four groups (G1-G4; n=6). Those groups were subjected to the following treatments for 7 consecutive days: G1 (control) received tocopherol stripped corn oil, G2 was given 60 mg/kg/day of δ-TCT mixture (contains 90% delta & 10% gamma isomers), G3 was given 60 mg/kg/day of pure δ-TCT (>98% purity) and G4 received 60 mg/kg/day α-TOC. On Day 8, females were superovulated with 5 IU Pregnant Mare’s Serum Gonadotropin (PMSG) for 48 hours followed with 5 IU human Chorionic Gonadotropin (hCG) before mated with males at the ratio of 1:1. Females were sacrificed by cervical dislocation for embryo collection 48 hours post-coitum. About fifty morula from each group were used in the gene expression analyses using Affymetrix QuantiGene Plex 2.0 Assay. Present data showed a significant increase (p< 0.05) in the average number (mean + SEM) of morula produced in G2 (26.0 + 0.45), G3 (23.0 + 0.63) and G4 (25.0 + 0.73) compared to control group (G1 – 16.0 + 0.63). This is parallel with the high expression of PDK1 gene with increase of 2.75-fold (G2), 3.07-fold (G3) and 3.59-fold (G4) compared to G1 (1.78-fold). From the present data, it can be concluded that supplementation with δ-TCT(s) and α-TOC induced high expression of PDK1 in G2-G4 which enhanced the PI3K/Akt signaling activity, resulting in the increased number of morula.
71
90798
The Effects of Androgen Receptor Mutation on Cryptorchid Testes in 46, XY Female
Abstract:
In the current study, we enrolled a 46, XY phenotypically female patient bearing testes in her inguinal canal. DNA sequencing of the AR gene detected a missense mutation C.1715A > G (p. Y572C) in exon 2 which is already known to cause Complete androgen insensitivity syndrome (CAIS). We further studied the effects of this mutation on the testicular histopathology of the patient. No spermatocytes were seen in the surface spreading of testicular tissues while H&E staining showed that seminiferous tubules predominantly have only Sertoli cells. To confirm this meiotic failure is likely due to the current AR mutation we performed mRNA expression of genes associated with AR pathway, expression and location of the associated proteins in testicular tissues. Western blot and real-time PCR data showed that the patient had high levels of expression of AMH, SOX9, and INNB in testis. Tubules were stained with SOX9 and AMH which revealed Sertoli cell maturation arrest. Therefore, we suggest that AR mutation enhances AMH expression which ultimately leads to failure in the maturation of Sertoli cells and failure in spermatogenesis.
70
16841
Computational Model for Predicting Effective siRNA Sequences Using Whole Stacking Energy (ΔG) for Gene Silencing
Abstract:
The small interfering RNA (siRNA) alters the regulatory role of mRNA during gene expression by translational inhibition. Recent studies shows that up regulation of mRNA cause serious diseases like Cancer. So designing effective siRNA with good knockdown effects play an important role in gene silencing. Various siRNA design tools had been developed earlier. In this work, we are trying to analyze the existing good scoring second generation siRNA predicting tools and to optimize the efficiency of siRNA prediction by designing a computational model using Artificial Neural Network and whole stacking energy (ΔG), which may help in gene silencing and drug design in cancer therapy. Our model is trained and tested against a large data set of siRNA sequences. Validation of our results is done by finding correlation coefficient of experimental versus observed inhibition efficacy of siRNA. We achieved a correlation coefficient of 0.727 in our previous computational model and we could improve the correlation coefficient up to 0.753 when the threshold of whole tacking energy is greater than or equal to -32.5 kcal/mol.
69
67598
The Effects of Grape Waste Bioactive Compounds on the Immune Response and Oxidative Stress in Pig Kidney
Abstract:
Nutrition is an important determinant of general health status, with especially focus on prevention and/or attenuation of the inflammatory-associated pathologies. People with chronic kidney disease can experience chronic inflammation that can lead to cardiovascular disease and even an increased rate of death. There are important links between chronic kidney diseases, inflammation and nutritional strategies that may prevent or protect against undesirable inflammation and oxidative stress. The grape by-products either seeds or pomace are rich in polyphenols which may be beneficial in prevention of inflammatory, antioxidant and antimicrobial processes. As a model for studying the impact of grape seeds on renal inflammation and oxidative stress, we used in this study weaned piglets. After a feeding trial of 30 days with a control diet and an experimental diet containing 5% grape seed (GS), kidney samples were collected. In renal tissues were determined the expression and activity of important markers of immune respose and oxidative stress: pro-inflammatory cytokines (TNF-alpha, IL-1 beta, IL-6, IL-8, IFN-gamma), anti-inflammatory cytokines (IL-4, IL-10), anti-oxidant enzymes (catalase CAT, superoxide dismutase SOD, glutathione peroxidise GPx) and important mediators belonging to nuclear receptors (NF-kB1, Nrf-2 and PPAR-gamma). Gene expression was evaluated by qPCR, whereas protein concentration was determined using proteomic techniques (ELISA). The activity of anti-oxidant enzymes was determined using specific kits. Our results showed that GS enriched in polyphenols does not have effect on TNF-alpha, IL-6 and IL-1 beta gene expression and protein concentration in kidney. By contrast, the gene expression and protein level of IL-8 and IFN-gamma were decreased in GS kidney. Anti-inflammatory cytokines IL-4 and IL-10 gene levels were increased in kidneys collected from GS piglets in comparison with controls, with no modification of protein levels between the two groups. The activities of anti-oxidant enzymes CAT and GPx were increased in kidney by GS, whereas SOD activity was unmodified in comparison with control samples. Also, the GS diet was associated with no modulation of mRNAs for nuclear receptors NF-kB1, Nrf-2 and PPAR-gamma gene expressions in kidneys. In conclusion, our results demonstrated that GS enriched in bioactive compounds such polyphenols could modulate inflammation and oxidative stress markers in kidney tissues. Further studies are necessary to elucidate the mechanism of action of GS compounds in case kidney inflammation associated with oxidative stress, and signalling molecules involved in these mechanisms.
68
44754
Effects of Oxidized LDL in M2 Macrophages: Implications in Atherosclerosis
Abstract:
Introduction: Atherosclerosis is a chronic disease where two striking features are observed: retention of lipids and inflammation. Understanding the interaction between immune cells and lipoproteins involved in atherogenesis are urgent challenges, since cardiovascular diseases are the leading cause of death worldwide. Macrophages are critical to the development of atherosclerotic plaques and in the perpetuation of inflammation in these lesions. These cells are also directly involved in unstable plaque rupture. Recently different populations of macrophages are being identified in atherosclerotic lesions. Although the presence of M2 macrophages (macrophages activated by the alternative pathway, eg. The IL-4) has been identified, the function of these cells in atherosclerosis is not yet defined. M2 macrophages have a high endocytic capacity, they promote remodeling of tissues and to have anti-inflammatory activity. However, in atherosclerosis, especially unstable plaques, severe inflammatory reaction, accumulation of cellular debris and intense degradation of the tissue is observed. Thus, it is possible that the M2 macrophages have altered function (phenotype) in atherosclerosis. Objective: Our aim is to evaluate if the presence of oxidized LDL alters the phenotype and function of M2 macrophages in vitro. Methods: For this, we will evaluate whether the addition of lipoprotein in M2 macrophages differentiated in vitro with IL -4 induces 1) a reduction in the secretion of anti-inflammatory cytokines (CBA and ELISA), 2) secretion of inflammatory cytokines (CBA and ELISA), 3) expression of cell activation markers (Flow cytometry), 4) alteration in gene expression of molecules adhesion and extracellular matrix (Real-Time PCR) and 5) Matrix degradation (confocal microscopy). Results: In oxLDL stimulated M2 macrophages cultures we did not find any differences in the expression of the cell surface markers tested, including: HLA-DR, CD80, CD86, CD206, CD163 and CD36. Also, cultures stimulated with oxLDL had similar phagocytic capacity when compared to unstimulated cells. However, in the supernatant of these cultures an increase in the secretion of the pro-inflammatory cytokine IL-8 was detected. No significant changes where observed in IL-6, IL-10, IL-12 and IL-1b levels. The culture supernatant also induced massive extracellular matrix (produced by mouse embryo fibroblast) filaments degradation. When evaluating the expression of 84 extracellular matrix and adhesion molecules genes, we observed that the stimulation of oxLDL in M2 macrophages decreased 47% of the genes and increased the expression of only 3% of the genes. In particular we noted that oxLDL inhibit the expression of 60% of the genes constituents of extracellular matrix and collagen expressed by these cells, including fibronectin1 and collagen VI. We also observed a decrease in the expression of matrix protease inhibitors, such as TIMP 2. On the opposite, the matricellular protein thrombospondin had a 12 fold increase in gene expression. In the presence of native LDL 90% of the genes had no altered expression. Conclusion: M2 macrophages stimulated with oxLDL secrete the pro-inflammatory cytokine IL-8, have an altered extracellular matrix constituents gene expression, and promote the degradation of extracellular matrix. M2 macrophages may contribute to the perpetuation of inflammation in atherosclerosis and to plaque rupture.
67
65286
Ordinary Differentiation Equations (ODE) Reconstruction of High-Dimensional Genetic Networks through Game Theory with Application to Dissecting Tree Salt Tolerance
Abstract:
Ordinary differentiation equations (ODE) have proven to be powerful for reconstructing precise and informative gene regulatory networks (GRNs) from dynamic gene expression data. However, joint modeling and analysis of all genes, essential for the systematical characterization of genetic interactions, are challenging due to high dimensionality and a complex pattern of genetic regulation including activation, repression, and antitermination. Here, we address these challenges by unifying variable selection and game theory through ODE. Each gene within a GRN is co-expressed with its partner genes in a way like a game of multiple players, each of which tends to choose an optimal strategy to maximize its “fitness” across the whole network. Based on this unifying theory, we designed and conducted a real experiment to infer salt tolerance-related GRNs for Euphrates poplar, a hero tree that can grow in the saline desert. The pattern and magnitude of interactions between several hub genes within these GRNs were found to determine the capacity of Euphrates poplar to resist to saline stress.
66
120043
Micro-Ribonucleic Acid-21 as High Potential Prostate Cancer Biomarker
Abstract:
Cancer is the leading cause of death worldwide. Cancer is caused by mutations that alter the function of normal human genes and give rise to cancer genes. MicroRNA (miRNA) is a small non-coding RNA that regulates the gen through complementary bond towards mRNA target and cause mRNA degradation. miRNA works by either promoting or suppressing cell proliferation. miRNA level expression in cancer may offer another value of miRNA as a biomarker in cancer diagnostic. miRNA-21 is believed to have a role in carcinogenesis by enhancing proliferation, anti-apoptosis, cell cycle progression and invasion of tumor cells. Hsa-miR-21-5p marker has been identified in Prostate Cancer (PCa) and Benign Prostatic Hyperplasia (BPH) patient’s urine. This research planned to explore the diagnostic performance of miR-21 to differentiate PCa and BPH patients. In this study, urine samples were collected from 20 PCa patients and 20 BPH patients. miR-21 relative expression against the reference gene was analyzed and compared between the two. miRNA expression was analyzed using the comparative quantification method to find the fold change. miR-21 validity in identifying PCa patients was performed by quantifying the sensitivity and specificity with the contingency table. miR-21 relative expression against miR-16 in PCa patient and in BPH patient has 12,98 differences in fold change. From a contingency table of Cq expression of miR-21 in identifying PCa patients from BPH patient, Cq miR-21 has 100% sensitivity and 75% specificity. miR-21 relative expression can be used in discriminating PCa from BPH by using a urine sample. Furthermore, the expression of miR-21 has higher sensitivity compared to PSA (Prostate specific antigen), therefore miR-21 has a high potential to be analyzed and developed more.
65
70927
Mutations in MTHFR Gene Associated with Mental Retardation and Cerebral Palsy Combined with Mental Retardation in Erbil City
Abstract:
Folate metabolism plays a crucial role in the normal development of the neonatal central nervous system. It is regulated by MTHFR gene polymorphism. Any factors, which will affect this metabolism either by hereditary or gene mutation will lead to many mental disorders. The purpose of this study was to investigate whether MTHFR gene mutation contributes to the development of mental retardation and CP combined with mental retardation in Erbil city. DNA was isolated from the peripheral blood samples of 40 cases suffering from mental retardation (MR) and CP combined with MR were recruited, sequence the 4, 6, 7, 8 exons of the MTHFR gene were done to identify the variants. Exons were amplified by PCR technique and then sequenced according to Sanger method to show the differences with MTHFR reference sequences. We observed (14) mutations in 4, 6, 7, 8 exons in the MTHFR gene associated with Cerebral Palsy combined with mental retardation included deletion, insertion, Substitution. The current study provides additional evidence that multiple variations in the MTHFR gene are associated with mental retardation and Cerebral Palsy.
64
74923
Time-Course Lipid Accumulation and Transcript Analyses of Lipid Biosynthesis Gene of Chlorella sp.3 under Nitrogen Limited Condition
Abstract:
The freshwater microalgae Chlorella sp. is alluring considerable interest as a source for biofuel production due to its fast growth rate and high lipid content. Under nitrogen limited conditions, they can accumulate significant amounts of lipids. Thus, it is important to gain insight into the molecular mechanism of their lipid metabolism. In this study under nitrogen limited conditions, regular pattern of growth characteristics lipid accumulation and gene expression analysis of key regulatory genes of lipid biosynthetic pathway were carried out in microalgae Chlorella sp 3. Our results indicated that under nitrogen limited conditions there is a significant increase in the lipid content and lipid productivity, achieving 44.21±2.64 % and 39.34±0.66 mg/l/d at the end of the cultivation, respectively. Time-course transcript patterns of lipid biosynthesis genes i.e. acetyl coA carboxylase (accD) and diacylglycerol acyltransferase (dgat) showed that during late log phase of microalgae Chlorella sp.3 both the genes were significantly up regulated as compared to early log phase. Moreover, the transcript level of the dgat gene is two-fold higher than the accD gene. The results suggested that both the genes responded sensitively to the nitrogen limited conditions during the late log stage, which proposed their close relevance to lipid biosynthesis. Further, this transcriptome data will be useful for engineering microalgae species by targeting these genes for genetic modification to improve microalgal biofuel quality and production.
63
112137
The Use of Bleomycin and Analogues to Probe the Chromatin Structure of Human Genes
Abstract:
The chromatin structure at the transcription start sites (TSSs) of genes is very important in the control of gene expression. In order for gene expression to occur, the chromatin structure at the TSS has to be altered so that the transcriptional machinery can be assembled and RNA transcripts can be produced. In particular, the nucleosome structure and positioning around the TSS has to be changed. Bleomycin is utilized as an anti-tumor agent to treat Hodgkin's lymphoma, squamous cell carcinoma, and testicular cancer. Bleomycin produces DNA damage in human cells and DNA strand breaks, especially double-strand breaks, are thought to be responsible for the cancer chemotherapeutic activity of bleomycin. Bleomycin is a large glycopeptide with molecular weight of approximately 1500 Daltons and hence its DNA strand cleavage activity can be utilized as a probe of chromatin structure. In this project, Illumina next-generation DNA sequencing technology was used to determine the position of DNA double-strand breaks at the TSSs of genes in intact cells. In this genome-wide study, it was found that bleomycin cleavage preferentially occurred at the TSSs of actively transcribed human genes in comparison with non-transcribed genes. There was a correlation between the level of enhanced bleomycin cleavage at TSSs and the degree of transcriptional activity. In addition, bleomycin was able to determine the position of nucleosomes at the TSSs of human genes. Bleomycin analogues were also utilized as probes of chromatin structure at the TSSs of human genes. In a similar manner to bleomycin, the bleomycin analogues 6′-deoxy-BLM Z and zorbamycin preferentially cleaved at the TSSs of human genes. Interestingly this degree of enhanced TSS cleavage inversely correlated with the cytotoxicity (IC50 values) of BLM analogues. This indicated that the degree of cleavage by bleomycin analogues at the TSSs of human genes was very important in the cytotoxicity of bleomycin and analogues. It also provided a deeper insight into the mechanism of action of this cancer chemotherapeutic agent since actively transcribed genes were preferentially targeted.
62
42512
Identification of Tissue-Specific Transcription Factors in C. roseus with Emphasis to the TIA Biosynthetic Pathway
Abstract:
Transcriptome retrieved from SRA database of different tissues and treatments of C. roseus was assembled in order to detect tissue-specific transcription factors (TFs) and TFs possibly related to terpenoid indole alkaloids (TIA) pathway. A number of 290 TF-like transcripts along with 12 transcripts related to TIA biosynthetic pathway were divided in terms of co-expression in the different tissues, treatments and genotypes. Three transcripts encoding peroxidases 1 and 12 were downregulated in hairy root, while upregulated in mature leaf. Eight different transcripts of the TIA pathway co-expressed with TFs either functioning downstream tryptophan biosynthesis, e.g., tdc, str1 and sgd, or upstream vindoline biosynthesis, e.g., t16h, omt, nmt, d4h and dat. The results showed no differential expression of TF transcripts in hairy roots knocked down for tdc gene (TDCi) as compared to their wild type controls. There were several evidences of tissue-specific expression of TF transcripts in flower, mature leaf, root/hairy root, stem, seedling, hairy root and immature/mature leaves. Regulation included transcription factor families, e.g., bHLH, MYB and WRKY mostly induced by ABA and/or JA (or MeJA) and regulated during abiotic or biotic stress. The information of tissue-specific regulation and co-expression of TFs and genes in the TIA pathway can be utilized in manipulating alkaloid biosynthesis in C. roseus.
61
49151
An Integrated Visualization Tool for Heat Map and Gene Ontology Graph
Abstract:
Microarray is a general scheme to find differentially expressed genes for target concept. The output is expressed by heat map, and biologists analyze related terms of gene ontology to find some characteristics of differentially expressed genes. In this paper, we propose integrated visualization tool for heat map and gene ontology graph. Previous two methods are used by static manner and separated way. Proposed visualization tool integrates them and users can interactively manage it. Users may easily find and confirm related terms of gene ontology for given differentially expressed genes. Proposed tool also visualize connections between genes on heat map and gene ontology graph. We expect biologists to find new meaningful topics by proposed tool.
60
24438
Reversal of Testicular Damage and Subfertility by Resveratrol
Abstract:
This effect of Resveratrol (RES) against CdCl2- induced toxicity in the rat testes was investigated. Seven experimental groups of adult male rats were formulated as follows: A) Controls + NS, B) Control+ vehicle (saline solution of hydroxypropyl cyclodextrin), C) RES treated, D) CdCl2 +NS, E) CdCl2+ vehicle, F) RES followed by CdCl2 and M) CdCl2 followed by RES. At the end of the protocol, serum levels of FSH, LH, and testosterone were measured in all groups. Testicular levels of TBARS and Super Oxide Dismutase (SOD) activity were also measured. Epidydidimal semen analysis was performed and testicular expression of Bcl-2, p53 and Bax were assessed by RT-PCR. Also, histopathological changes of testes were examined microscopically and described. Pre and Post administration of RES in cadmium chloride-intoxicated rats improved semen parameters including count, motility, daily sperm production and morphology, increased serum concentrations of gonadotropins and testosterone, decreased testicular lipid peroxidation and increased SOD activity. Not only RES attenuated cadmium chloride induced testicular histopathology but was also able to protect against the onset of cadmium chloride testicular toxicity. Cadmium chloride downregulated the anti-apoptotic gene Bcl2 and upregulated the expression of both pro-apoptotic genes p53 and Bax. Resveratrol protected from and partially reversed cadmium chloride testicular via upregulation of Bcl2 and down regulation of p53 and Bax gene expression. Antioxidant activity of RES protects against cadmium chloride testicular toxicity and partially reverses its effect via upregulation of BCl2 and downregulation of p53 and Bax expression. These findings have far reaching implications on subfertility and impotency frequently seen in hypertensive as well as metabolic syndrome patients.
59
13619
Variation in Carboxylesterase Activity in Spodoptera litura Fabricious (Noctuidae: Lepidoptera) Populations from India
Abstract:
The tobacco caterpillar, Spodoptera litura Fab (Lepidoptera: Noctuidae) is a polyphagous pest various field and horticulture crops in India. Pest had virtually developed resistance to all commonly used insecticides. Enhanced detoxification is the prime mechanism that is dictated by detoxification different enzymes and carboxylesterase is one of the major enzyme responsible development of resistance. In India, insecticide resistance studies on S. litura are mainly deployed on detoxification enzymes activity and investigation at gene level alteration i.e. at nucleotide level is very merger. In the present study, we collected the S. litura larvae from three different cauliflower growing belt viz., IARI, New Delhi (Delhi), Palari, Sonepat (Haryana) and Varanasi (Uttar Pradesh) to study the role of carboxylesterase activity and its gene level variation The CarE activity was measured using UV-VIS spectrophotometer with 3rd instar larvae of S. litura. The elevated activity of CarE was observed in Sonepat strain (28.09 ± 0.09 µmol/min/mg of protein) followed by Delhi (26.72 ± 0.04 µmol/min/mg of protein) and Varanasi strain (10.00 ± 0.44 µmol/min/mg of protein) of S. litura. The genomic DNA was isolated from 3rd instar larvae and CarE gene was amplified using a primer sequence, F:5’tccagagttccttgtcaggcac3’; R:5’ctgcatcaagcatgtctc3. CarE gene, about 500bp was partially amplified, sequenced and submitted to NCBI (Accession No. KF835886, KF835887 and KF835888). The sequence data revealed polymorphism at nucleotide level in all the three strains and gene found to have 88 to 97% similarity with previous available nucleotide sequences of S. litura, S. littoralis and S. exiqua. The polymorphism at the nucleotide level could be a reason for differential activity of carboxylesterase enzymes among the strains. However, investigation at gene expression level would be useful to analyze the overproduction of carboxylesterase enzyme.
58
61153
Effects of Pterostilbene in Brown Adipose Tissue from Obese Rats
Abstract:
Introduction: In recent years great attention has been paid by scientific community to phenolic compounds as active biomolecules naturally present in foodstuffs due to their beneficial effects on health. Pterostilbene is a resveratrol dimethylether derivative which shows higher biodisponibility. Objective. To analyze the effects of two doses of pterostilbene on several markers of thermogenic capacity in a model of genetic obesity, which shows reduced thermogenesis. Methods: The experiment was conducted with thirty Zucker (fa/fa) rats that were distributed in 3 experimental groups, the control group and two groups orally administered with pterostilbene at 15 and 30 mg/kg body weight/day for 6 weeks. Gene expression of Ucp1, Pgc-1α, Cpt1b, Pparα, Nfr1, Tfam and Cox-2 were assessed by RT-PCR, protein expression of UCP1 and GLUT4 by western blot and enzyme activity of carnitine palmitoyl transferase 1b and citrate synthase by spectrophotometry in interscapular brown adipose tissue (iBAT). Statistical analysis was performed by using one way ANOVA and Newman-Keuls as post-hoc test. Results: Pterostilbene did not change gene expression of Pgc-1α. However, significant increases were found in the expression of Ucp1, Pparα, Nfr-1 and Cox-2. Protein expression of UCP1 and GLUT4 was increased in animals treated with pterostilbene, as well as the activities of CPT-1b and CS. These effects were observed with both doses of pterostilbene, without differences between them. Conclusions: These results show that pterostilbene increases thermogenic and oxidative capacity of brown adipose tissue in obese rats. Whether these effects effectively contribute to the anti-obesity properties of these compound needs further research. Acknowledgments: MINECO-FEDER (AGL2015-65719-R), Basque Government (IT-572-13), University of the Basque Country (ELDUNANOTEK UFI11/32), Institut of Health Carlos III (CIBERobn). Iñaki Milton is a fellowship from the Basque Government.
57
78861
Engineering C₃ Plants with SbtA, a Cyanobacterial Transporter, for Enhancing CO₂ Fixation
Abstract:
The cyanobacterial CO₂ concentrating mechanism (CCM) operates to raise the levels of CO₂ in the vicinity of the main carboxylation enzyme Rubisco which is encapsulated in protein micro compartments called carboxysomes. Thus, due to the presence of CCM, cyanobacterial cells are able to work with high photosynthetic efficiency even at low Ci conditions and can accumulate 1000 folds high internal concentrations of Ci than external environment. Engineering of some useful CCM components into higher plants is one of the plausible approaches to improve their photosynthetic performance. The first step and the simplest approach for attaining this objective would be the transfer of cyanobacterial bicarbonate transporter such as SbtA to inner chloroplast envelope of C₃ plants. For this, SbtA transporter gene from Synechococcus elongatus PCC 7942 was fused to a transit peptide element to generate chimeric constructs in order to direct it to chloroplast inner envelope. Two transit peptides namely, TnaXTP (transit peptide from AT3G56160) and TMDTP (transit peptide from AT2G02590) were shortlisted from Arabidopsis thaliana genome and cloned in plant expression vector pCAMBIA1302 having mgfp5 as a reporter gene. Plant transformation was done by agro infiltration and Agrobacterium mediated co-culture. DNA, RNA, and protein were isolated from the leaves four days post infiltration, and the presence of transgene was confirmed by gene specific PCR (Polymerase Chain Reaction) analysis and by RT-PCR (Reverse Transcription Polymerase Chain Reaction). The expression was confirmed at the protein level by western blotting using anti-GFP primary antibody and horseradish peroxidase (HRP) conjugated secondary antibody. The localization of the protein was detected by confocal microscopy of isolated protoplasts. We observed chloroplastic expression for both the fusion constructs which suggest that the transit peptide sequences are capable of taking the cargo protein to the chloroplasts. These constructs are now being used to generate stable transgenic plants by Agrobacterium mediated transformation. The stability of transgene expression will be analyzed from T₀ to T₂ generation.
56
3196
Goblet cells and Mucin Related Gene Expression in Mice Infected with Eimeria papillata
Abstract:
Coccidiosis causes considerable economic loss in the poultry industry. The current study aimed to investigate the response of goblet cells as well as the induced tissue damage during Eimeria papilata infection. Mice were infected with sporulated E. papillata oocyts. On day 5 post-infection, the fecal output was determined. Also, the jejunum was prepared for the histological, histochemical and molecular studies. Our results revealed that the intestinal coccidian infection with E. papillata induced a marked goblet cell hypoplasia and depleted mucus secretion. Also, the infection was able to alter the jejuna architecture and increased the apoptotic cells inside the villi. In addition, the real time PCR results indicated that, the inflammatory cytokines TNF-α, iNOS, IFN-y and IL-1β were significantly up-regulated. In contrast, the mRNA expression patterns of IL-6 in response to E. papillata infection did not differ significantly between control and infected mice. Moreover, the mRNA expression of TLR4 was significantly up-regulated, whereas the expression of MUC2 is significantly down-regulated upon infection. Further studies are required to understand the regulatory mechanisms of goblet cells related genes.
55
90029
Utilizing the RhlR/RhlI Quorum Sensing System to Express the ß-Galactosidase Reporter Gene by Using the N-Butanoyl Homoserine Lactone and N-Hexanoyl Homoserine Lactone
Abstract:
Quorum sensing is a phenomenon present in many gram-negative bacteria that allows bacterial communication and controlled expression of a large suite of genes through quorum sensing signals - N-acyl homoserine lactones (AHLs). In order to investigate the ability of the rhlR/rhlI quorum sensing system in Pseudomonas aeruginosa to express the ß-Galactosidase reporter gene, an engineered E. coli strain EpHL02, was genetically engineered. This engineered E. coli strain EpHL02 responded to the presence of the N-butanoyl homoserine lactone and N-hexanoyl homoserine lactone to express the ß-Galactosidase reporter gene at a concentration limit of 5x10⁻⁸ M. This was also found to be comparable to AHLs extraction from Serratia marcescens H31. Moreover, we examined this ability of this engineered E. coli strain for respond of AHLs from extractions of Pseudomonas aeruginosa ATCC9027. The results demonstrated that the rhlR/rhlI quorum sensing system can express the ß-Galactosidase reporter gene by using the N-butanoyl homoserine lactone, N-hexanoyl homoserine lactone and AHLs from extractions of Serratia marcescens H31 and Pseudomonas aeruginosa ATCC9027 in the engineered E. coli strain EpHL02.
54
86237
Effect of Miconazole Nitrate on Immunological Response and Its Preventive Efficacy in Labeo rohita Fingerlings against Oomycetes Saprolegnia parasitica
Abstract:
The present study evaluated the effect of sub-lethal doses of antifungal drug miconazole nitrate (MCZ) on immunological responses including immune-related gene expression and its role as a prophylactic drug against S. parasitica in Labeo rohita fingerlings. Fish were fed with sub lethal doses of MCZ i.e., T1- 6.30 mg MCZ kgBW⁻¹, T2- 12.61 mg MCZ kgBW⁻¹ and T3- 25.22 mg MCZ kgBW⁻¹ and sampling was done at different time intervals for 240 h. Immunological parameters viz. lysozyme activity, oxygen radical production and plasma anti-protease activity showed significant enhancement (p < 0.05) in fish fed with T2 and T3 doses. Significant reduction in plasma protein content was observed in all the dietary groups as compared to control. Expression of immune-relevant genes like TLR-22 and β2-M showed significantly higher expression at six h and 24 h of sampling in both liver and head-kidney. However, these genes showed a down-regulation after 120 h of sampling in both the tissues. Preventive efficacy study showed that single dose of MCZ provides protection against oomycetes up to the fourth day of infection. Significantly higher mortality was observed in control diet-fed fish as compared to fish fed with MCZ medicated diet. Thus, from the study, it can be concluded that the MCZ can act as a potent antifungal agent for preventing oomycetes infection as well as to enhance the immune response.
53
46654
Mechanical Properties of Young and Senescence Fibroblast Cells Using Passive Microrheology
Abstract:
Biological aging is a multi-dimensional process that takes place over a whole range of scales from the nanoscopic alterations within individual cells, over transformations in tissues and organs and to changes of the whole organism. On the single cell level, aging involves mutation of genes, differences in gene expression levels as well as altered posttranslational modifications of proteins. A variety of proteins is affected, including proteins of the cell cytoskeleton and migration machinery. Previous work quantified the expression of cytoskeleton proteins on the gene and protein levels in senescent and young fibroblasts. Their results show that senescent skin fibroblasts have an upregulated expression of the intermediate filament (IF) protein vimentin in contrast to actin and tubulin, which are downregulated. IFs play an important role in providing mechanical stability of cells. However, the mechanical properties of IFs depending on cellular senescence or age of the donor has not been studied so far. Hence, we employed passive microrheology on primary human dermal fibroblasts from female donors with age of 28 years (young) and 86 years (old) as model of in vivo aging and human normal dermal fibroblast from 11-year old male with CPD 17-35 (young) and CPD 58-59 (senescence) as a model of in vitro replicative senescence. In contrast to the expectations, our primary results show no significant differences in the viscoelastic properties of fibroblasts depending on age of the donor or cellular replicative senescence.
52
96859
Gene Cloning and Expression of Azoreductases from Azo-Degraders Lysinibacillus macrolides and Bacillus coagulans Isolated from Egyptian Industrial Wastewater
Abstract:
Textile industry is one of the important industries in the worldwide. It is known that the eco-friendly industrial and agricultural activities are significant for socio-economic stability of all countries. The absence of appropriate industrial waste water treatments is essential barrier for sustainable development in food and agricultural sectors especially in developing country like Egypt. Thus, the development of enzymatic bioremediation technology for textile dye removal will enhance the collaboration between scientists who develop the technology and industry where this technology will be implemented towards the safe disposal of the textile dye wastes. Highly efficient microorganisms are of most importance in developing and using highly effective biological treatment processes. Bacterial degradation of azo dyes is generally initiated by an enzymatic step that involves cleavage of azo linkages, usually with the aid of an azoreductase as electron donor. Thus, expanding the spectrum of microorganisms with high enzymatic activities as azoreductases and discovering novel azo-dye degrading enzymes, with enhanced stability and superior catalytic properties, are necessary for many environmental and industrial applications. Consequently, the use of molecular tools has become increasingly integrated into the understanding of enzyme properties and characterization. Researchers have utilized a gene cloning and expression methods as a tool to produce recombinant protein for decolorizing dyes more efficiently. Thus, presumptive evidence for the presence of genes encoding azoreductases in the genomes of selected local, and most potent azo-degrading strains were obtained by using specific oligonucleotides primers. These potent strains have been isolated from textile industrial wastewater in Egypt and identified using 16S rRNA sequence analysis as 'Lysinibacillus macrolidesB8, Brevibacillus parabrevisB11, Bacillus coagulansB7, and B. cereusB5'. PCR products of two full length genes designated as (AZO1;621bp and AZO2;534bp) were detected. BLASTx results indicated that AZO1 gene was corresponding to predicted azoreductase from of Bacillus sp. ABP14, complete genome, multispecies azoreductase [Bacillus], It was submitted to the gene bank by an accession no., BankIt2085371 AZO1 MG923210 (621bp; 207 amino acids). AZO1 was generated from the DNA of our identified strains Lysinibacillus macrolidesB8. On the other hand, AZO2 gene was corresponding to a predicted azoreductase from Bacillus cereus strain S2-8. Gene bank accession no. was BankIt2085839 AZO2 MG932081 (534bp;178 amino acids) and it was amplified from our Bacillus coagulansB7. Both genes were successfully cloned into pCR2.1TOPO (Invitrogen) and in pET28b+ vectors, then they transformed into E. coli DH5α and BL21(DE3) cells for heterologous expression studies. Our recombinant azoreductases (AZO1&AZO2) exhibited potential enzyme activity and efficiently decolorized an azo dye (Direct violet). They exhibited pH stability between 6 and 8 with optimum temperature up to 60°C and 37 °C after induction by 1mM and 1.5mM IPTG, for both AZO1 &AZO2, respectively. These results suggested that further optimization and purification of these recombinant proteins by using different heterologous expression systems will give great potential for the sustainable utilization of these recombinant enzymes in several industrial applications especially in wastewater treatments.
51
32386
Immunoliposomes for Co-Delivery of Doxorubicin and Ribonucleotide Reductase M2 Sirna Inhibit of Gastric Cancer Growth
Authors:
Abstract:
The combination of chemotherapy with gene therapy is highly effective in cancer therapy. To achieve combined therapeutic effects in human gastric cancer over expressing EGFR, we developed targeted LPD (liposome-polycation-DNA complex) conjugated with anti-EGFR (epidermal growth factor receptor) Fab’ for co-delivery of doxorubicin (DOX) and ribonucleotide reductase M2 (RRM2) siRNA (DOX-RRM2-TLPD). The results showed that EGFR was over expressed in several gastric cancer cell lines and gastric cancer tissues. Gene Expression Omnibus (GEO) results showed that RRM2 expression was significantly higher in gastric cancer than in non-gastric cancer tissue, and RRM2 siRNA inhibited the proliferation of several gastric cancer cells, indicating that RRM2 is a candidate target for gastric cancer therapy. Confocal studies and flow cytometry showed that DOX-RRM2-TLPD delivered DOX and RRM2 siRNA to EGFR over expressing gastric cancer cells specifically and efficiently both in vitro and in vivo, resulting in enhanced therapeutic effects (cytotoxicity and apoptosis) compared with single-drug loaded or non-targeted controls, including DOX-NC-TLPD (targeted LPD co-delivering DOX and negative control siRNA), RRM2-TLPD (targeted LPD delivering RRM2 siRNA) and DOX-RRM2-NTLPD (non-targeted LPD co-delivering DOX and RRM2 siRNA). The in vivo antitumor assay showed that the average weight of the gastric cancer in mice treated with DOX-RRM2-TLPD was significantly lighter than that of mice treated with other controls. DOX-RRM2-TLPD represents an effective approach for combined therapy of gastric cancer over expressing EGFR.
50
64261
Micro RNAs (194 and 135a) as Biomarkers and Therapeutic Targets in Type 2 Diabetic Rats
Abstract:
Background of the study: Type 2 diabetes is emerging as the predominant metabolic disorder in the world among adults characterized mainly by the resistance of the insulin sensitive tissues towards insulin followed by the decrease in the insulin secretion. The treatment for this disease usually involves treatment with oral synthetic drugs which are known to cause several side effects. Therefore, identification of new biomarkers as therapeutic target is the need of the hour. miRNAs are small, non–protein-coding RNAs that negatively regulate gene expression by promoting degradation and/or inhibit the translation of target mRNAs and have emerged as biomarkers in predicting diabetes mellitus. Objective of the study: To elucidate the therapeutic role of gallic acid in modulating the alterations in glucose metabolism induced by miRNAs 194 and 135a in Type 2 diabetic rats. Materials and Methods: T2D was induced in rats by feeding them with a high fat diet for 2 weeks followed by intraperitoneal injection of 35 mg/kg/body weight (b.wt.) of streptozotocin. Microarrays were used to assess the expression of miRNAs in control, diabetic and gallic acid treated rats. Gene expression studies were carried out by RT PCR analysis. Results: Forty one miRNAs were differentially expressed in Type 2 diabetic rats. Among these, the expression of miRNA 194 was significantly decreased whereas miRNA 135a was significantly increased in Type 2 diabetic rats. The glucose metabolism was also altered significantly in skeletal muscle of Type 2 diabetic rats. Conclusion: T2D is associated with alterations in the expression of miRNAs in skeletal muscle. Both these miRNAs 194 and 135a play an important role in glucose metabolism in skeletal muscle of diabetic rats. Gallic acid effectively ameliorated the alterations in glucose metabolism. Hence, both these miRNAs can serve as biomarkers and therapeutic targets in diabetes mellitus. The study also establishes the role of gallic acid as therapeutic agent. Acknowledgment: The financial assistance provided in the form of ICMR women scientist by ICMR DHR INDIA is gratefully acknowledged here.
49
134742
Single Cell and Spatial Transcriptomics: A Beginners Viewpoint from the Conceptual Pipeline
Abstract:
Messenger ribooxynucleic acid (mRNA) molecules are compositional, protein-based. These proteins, encoding mRNA molecules (which collectively connote the transcriptome), when analyzed by RNA sequencing (RNAseq), unveils the nature of gene expression in the RNA. The obtained gene expression provides clues of cellular traits and their dynamics in presentations. These can be studied in relation to function and responses. RNAseq is a practical concept in Genomics as it enables detection and quantitative analysis of mRNA molecules. Single cell and spatial transcriptomics both present varying avenues for expositions in genomic characteristics of single cells and pooled cells in disease conditions such as cancer, auto-immune diseases, hematopoietic based diseases, among others, from investigated biological tissue samples. Single cell transcriptomics helps conduct a direct assessment of each building unit of tissues (the cell) during diagnosis and molecular gene expressional studies. A typical technique to achieve this is through the use of a single-cell RNA sequencer (scRNAseq), which helps in conducting high throughput genomic expressional studies. However, this technique generates expressional gene data for several cells which lack presentations on the cells’ positional coordinates within the tissue. As science is developmental, the use of complimentary pre-established tissue reference maps using molecular and bioinformatics techniques has innovatively sprung-forth and is now used to resolve this set back to produce both levels of data in one shot of scRNAseq analysis. This is an emerging conceptual approach in methodology for integrative and progressively dependable transcriptomics analysis. This can support in-situ fashioned analysis for better understanding of tissue functional organization, unveil new biomarkers for early-stage detection of diseases, biomarkers for therapeutic targets in drug development, and exposit nature of cell-to-cell interactions. Also, these are vital genomic signatures and characterizations of clinical applications. Over the past decades, RNAseq has generated a wide array of information that is igniting bespoke breakthroughs and innovations in Biomedicine. On the other side, spatial transcriptomics is tissue level based and utilized to study biological specimens having heterogeneous features. It exposits the gross identity of investigated mammalian tissues, which can then be used to study cell differentiation, track cell line trajectory patterns and behavior, and regulatory homeostasis in disease states. Also, it requires referenced positional analysis to make up of genomic signatures that will be sassed from the single cells in the tissue sample. Given these two presented approaches to RNA transcriptomics study in varying quantities of cell lines, with avenues for appropriate resolutions, both approaches have made the study of gene expression from mRNA molecules interesting, progressive, developmental, and helping to tackle health challenges head-on.
48
79242
Effect of Extraction Methods on the Fatty Acids and Physicochemical Properties of Serendipity Berry Seed Oil
Abstract:
Serendipity berry (Dioscoreophyllum cumminsii diel) is a tropical dioecious rainforest vine and native to tropical Africa. The vine grows during the raining season and is used mainly as sweetener. The sweetener in the berry is known as monellin which is sweeter than sucrose. The sweetener is extracted from the fruits and the seed is discarded. The discarded seeds contain bitter principles but had high yield of oil. Serendipity oil was extracted using three methods (N-hexane, expression and expression/n-hexane). Fatty acids and physicochemical properties of the oil obtained were determined. The oil obtained was clear, liquid and have odour similar to hydrocarbon. The percentage oil yield was 38.59, 12.34 and 49.57% for hexane, expression and expression-hexane method respectively. The seed contained high percentage of oil especially using combination of expression and hexane. Low percentage of oil was obtained using expression method. The refractive index values obtained were 1.443, 1.442 and 1.478 for hexane, expression and expression-hexane methods respectively. Peroxide value obtained for expression-hexane was higher than those for hexane and expression. The viscosities of the oil were 125.8, 128.76 and 126.87 cm³/s for hexane, expression and expression-hexane methods respectively which showed that the oil from expression method was more viscous than the other oils. The major fatty acids in serendipity seed oil were oleic acid (62.81%), linoleic acid (22.65%), linolenic (6.11%), palmitic acid (5.67%), stearic acid (2.21%) in decreasing order. Oleic acid which is monounsaturated fatty acid had the highest value. Total unsaturated fatty acids were 91.574, 92.256 and 90.426% for hexane, expression, and expression-hexane respectively. Combination of expression and hexane for extraction of serendipity oil produced high yield of oil. The oil could be refined for food and non-food application.
47
46593
The Use of Medical Biotechnology to Treat Genetic Disease
Abstract:
Chemical drugs have been used for many centuries as the only way to cure diseases until the novel gene therapy has been created in 1960. Gene therapy is based on the insertion, correction, or inactivation of genes to treat people with genetic illness (1). Gene therapy has made wonders in Parkison’s, Alzheimer and multiple sclerosis. In addition to great promises in the healing of deadly diseases like many types of cancer and autoimmune diseases (2). This method implies the use of recombinant DNA technology with the help of different viral and non-viral vectors (3). It is nowadays used in somatic cells as well as embryos and gametes. Beside all the benefits of gene therapy, this technique is deemed by some opponents as an ethically unacceptable treatment as it implies playing with the genes of living organisms.
46
59238
PRKAG3 and RYR1 Gene in Latvian White Pigs
Abstract:
The aim of this study was to analyse PRKAG3 and RYR1 gene and genotypes frequencies in Latvian White pigs’ breed. Genotypes of RYR1 gene two loci (rs196953058 and rs323041392) in 89 exon and PRKAG3 gene two loci (rs196958025 and rs344045190) in gene promoter were detected in 103 individuals of Latvian white pigs’ breed. Analysis of RYR1 gene loci rs196953058 shows all individuals are homozygous by T allele and all animals are with genotypes TT, its mean - in 2769 position is Phenylalanine. Analysis of RYR1 gene loci rs323041392 shows all individuals are homozygous by G allele and all animals are with genotypes GG, its mean - in 4119 positions is Asparagine. In loci rs196953058 and rs323041392, there were no gene polymorphisms. All analysed individuals by two loci rs196953058-rs323041392 have TT-GG genotypes or Phe-Asp amino acids. In PRKAG3 gene loci rs196958025 and rs344045190 there was gene polymorphisms. In both loci frequencies for A allele was higher: 84.6% for rs196958025 and 73.0% for rs344045190. Analysis of PRKAG3 gene loci rs196958025 shows 74% of individuals are homozygous by An allele and animals are with genotypes AA. Only 4% of individuals are homozygous by G allele and animals are with genotypes GG, which is associated with pale meat colour and higher drip loss. Analysis of PRKAG3 gene loci rs344045190 shows 46% of individuals are homozygous with genotypes AA and 54% of individuals are heterozygous with genotypes AG. There are no individuals with GG genotypes. According to the results, in Latvian white pigs population there are no rs344435545 (RYR1 gene) CT heterozygous or TT recessive homozygous genotypes, which is related to the meat quality and pigs’ stress syndrome; and there are 4% rs196958025 (PRKAG3 gene) GG recessive homozygote genotypes, which is related to the meat quality. Acknowledgment: the investigation is supported by VPP 2014-2017 AgroBioRes Project No. 3 LIVESTOCK.
45
50742
A Web-Based Systems Immunology Toolkit Allowing the Visualization and Comparative Analysis of Publically Available Collective Data to Decipher Immune Regulation in Early Life
Abstract:
Collections of large-scale datasets made available in public repositories can be used to identify and fill gaps in biomedical knowledge. But first, these data need to be made readily accessible to researchers for analysis and interpretation. Here a collection of transcriptome datasets was made available to investigate the functional programming of human hematopoietic cells in early life. Thirty two datasets were retrieved from the NCBI Gene Expression Omnibus (GEO) and loaded in a custom, interactive web application called the Gene Expression browser (GXB), designed for visualization and query of integrated large-scale data. Multiple sample groupings and gene rank lists were created based on the study design and variables in each dataset. Web links to customized graphical views can be generated by users and subsequently be used to graphically present data in manuscripts for publication. The GXB tool also enables browsing of a single gene across datasets, which can provide information on the role of a given molecule across biological systems. The dataset collection is available online. As a proof-of-principle, one of the datasets (GSE25087) was re-analyzed to identify genes that are differentially expressed by regulatory T cells in early life. Re-analysis of this dataset and a cross-study comparison using multiple other datasets in the above mentioned collection revealed that PMCH, a gene encoding a precursor of melanin-concentrating hormone (MCH), a cyclic neuropeptide, is highly expressed in a variety of other hematopoietic cell types, including neonatal erythroid cells as well as plasmacytoid dendritic cells upon viral infection. Our findings suggest an as yet unrecognized role of MCH in immune regulation, thereby highlighting the unique potential of the curated dataset collection and systems biology approach to generate new hypotheses which can be tested in future mechanistic studies.
44
56065
Immune Responses and Pathological Manifestations in Chicken to Oral Infection with Salmonella typhimurium
Abstract:
Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) is a primary avian pathogen responsible for severe intestinal pathology in younger chickens and economic losses. However, the Salmonella Typhimurium is also able to cause infection in humans, described by typhoid fever and acute gastro-intestinal disease. A study was conducted at days to investigate pathological, histopathological, haemato-biochemical, immunological and expression kinetics of NRAMP (natural resistance associated macrophage protein) gene family (NRAMP1 and NRAMP2) in broiler chickens following experimental infection of Salmonella Typhimurium at 0,1,3,5,7,9,11,13 and 15 days respectively. Infection was developed in birds through oral route at 2×108 CFU/ml. Clinical symptoms appeared 4 days post infection (dpi) and after one-week birds showed progressive weakness, anorexia, diarrhea and lowering of head. On postmortem examination, liver showed congestion, hemorrhage and necrotic foci on surface, while as spleen, lungs and intestines revealed congestion and hemorrhages. Histopathological alterations were principally observed in liver in second week post infection. Changes in liver comprised of congestion, areas of necrosis, reticular endothelial hyperplasia in association with mononuclear cell and heterophilic infiltration. Hematological studies confirm a significant decrease (P< 0.05) in RBC count, Hb concentration and PCV. White blood cell count showed significant increase throughout the experimental study. An increase in heterophils was found up to 7dpi and a decreased pattern was observed afterwards. Initial lymphopenia followed by lymphocytosis was found in infected chicks. Biochemical studies showed a significant increase in glucose, AST and ALT concentration and a significant decrease (P< 0.05) in total protein and albumin level in the infected group. Immunological studies showed higher titers of IgG in infected group as compared to control group. The real time gene expression of NRAMPI and NRAMP2 genes increased significantly (P< 0.05) in infected group as compared to controls. The peak expression of NRAMP1 gene was seen in liver, spleen and caecum of infected birds at 3dpi, 5dpi and 7dpi respectively, while as peak expression of NRAMP2 gene in liver, spleen and caecum of infected chicken was seen at 9dpi, 5dpi and 9dpi respectively. This study has role in diagnostics and prognostics in the poultry industry for the detection of salmonella infections at early stages of poultry development.
43
25192
Potential Growth of Tomato Plants in Induced Saline Soil with Rhizobacteria (PGPR)
Abstract:
The critical evaluation of tolerance in tomato plants against the induced saline soil were assessed by transcript analysis of genes coding for products potentially involved in stress tolerance. A reverse transcriptase PCR experiment was performed with Hsp90-1, MT2, and GR1like protein genes using RNA isolated from different tissues of tomato plants. Four strains of Bacillus magisterium were inoculated with 100 Mm & 200 Mm concentrations of salt. Eleven treatments each ten replica pots were installed in green house experiment and the parameters taken into account were morphological (length, weight, number of leaves, leaf surface area), chemical (anthocyanin, chlorophyll-a, chlorophyll-b, carotenoids) and biological (gene expression). Results bare a response i.e. highest response of MT2 like gene was at 24 hpi and the highest levels of GR1 like protein transcript accumulation were detected at 36 hpi. The chemical and morphological parameters at diverse salt concentrations bequeath superlative response amongst strains which candidly flank on Zm7 and Zm4. Therefore, Bacillus magisterium Zm7 strains and somehow Zm4 strain can be used in saline condition to make plants tolerant. The overall performance of strains Zm7, Zm6, and Zm4 was found better for all studied traits under salt stress conditions. Significant correlations among traits root length, shoot length, number of leaves, leaf surface area, carotenoids, anthocyanin, chlorophyll-a and chlorophyll-b were found and suggested that the salt tolerance in tomato may be improved through the use of PGPR strains.
42
22070
Bioinformatic Study of Follicle Stimulating Hormone Receptor (FSHR) Gene in Different Buffalo Breeds
Abstract:
World wild, buffalo production is considered as most important component of food industry. Efficient buffalo production is related with reproductive performance of this species. Lack of knowledge of reproductive efficiency and its related genes in buffalo species is a major constraint for sustainable buffalo production. In this study, we performed some bioinformatics analysis on Follicle Stimulating Hormone Receptor (FSHR) gene and explored the possible relationship of this gene among different buffalo breeds and with other farm animals. We also found the evolution pattern for this gene among these species. We investigate CDS lengths, Stop codon variation, homology search, signal peptide, isoelectic point, tertiary structure, motifs and phylogenetic tree. The results of this study indicate 4 different motif in this gene, which are Activin-recp, GS motif, STYKc Protein kinase and transmembrane. The results also indicate that this gene has very close relationship with cattle, bison, sheep and goat. Multiple alignment (MA) showed high conservation of motif which indicates constancy of this gene during evolution. The results of this study can be used and applied for better understanding of this gene for better characterization of Follicle Stimulating Hormone Receptor (FSHR) gene structure in different farm animals, which would be helpful for efficient breeding plans for animal’s production.
41
16109
Using Baculovirus Expression Vector System to Express Envelop Proteins of Chikungunya Virus in Insect Cells and Mammalian Cells
Abstract:
Currently, Chikungunya virus (CHIKV) transmitted to humans by Aedes mosquitoes has distributed from Africa to Southeast Asia, South America, and South Europe. However, little is known about the antigenic targets for immunity, and there are no licensed vaccines or specific antiviral treatments for the disease caused by CHIKV. Baculovirus has been recognized as a novel vaccine vector with attractive characteristic features of an optional vaccine delivery vehicle. This approach provides the safety and efficacy of CHIKV vaccine. In this study, bi-cistronic recombinant baculoviruses vAc-CMV-CHIKV26S-Rhir-EGFP and vAc-CMV-pH-CHIKV26S-Lir-EGFP were produced. Both recombinant baculovirus can express EGFP reporter gene in insect cells to facilitate the recombinant virus isolation and purification. Examination of vAc-CMV-CHIKV26S-Rhir-EGFP and vAc-CMV-pH-CHIKV26S-Lir-EGFP showed that this recombinant baculovirus could induce syncytium formation in insect cells. Unexpectedly, the immunofluorescence assay revealed the expression of E1 and E2 of CHIKV structural proteins in insect cells infected by vAc-CMV-CHIKV26S-Rhir-EGFP. This result may imply that the CMV promoter can induce the transcription of CHIKV26S in insect cells. There are also E1 and E2 expression in mammalian cells transduced by vAc-CMV-CHIKV26S-Rhir-EGFP and vAc-CMV-pH-CHIKV26S-Lir-EGFP. The expression of E1 and E2 proteins of insect and mammalian cells was validated again by Western blot analysis. The vector construction with dual tandem promoters, which is polyhedrin and CMV promoter, has higher expression of the E1 and E2 of CHIKV structural proteins than the vector construction with CMV promoter only. Most of the E1 and E2 proteins expressed in mammalian cells were glycosylated. In the future, the expression of structural proteins of CHIKV in mammalian cells is expected can form virus-like particle, so it could be used as a vaccine for chikungunya virus.
40
8594
Polymorphism of Candidate Genes for Meat Production in Lori Sheep
Abstract:
Calpastatin and callipyge have been known as one of the candidate genes in meat quality and quantity. Calpastatin gene has been located to chromosome 5 of sheep and callipyge gene has been localized in the telomeric region on ovine chromosome 18. The objective of this study was identification of calpastatin and callipyge genes polymorphism and analysis of genotype structure in population of Lori sheep kept in Iran. Blood samples were taken from 120 Lori sheep breed and genomic DNA was extracted by salting out method. Polymorphism was identified using the PCR-RFLP technique. The PCR products were digested with MspI and FaqI restriction enzymes for calpastatin gene and callipyge gene, respectively. In this population, three patterns were observed and AA, AB, BB genotype have been identified with the 0.32, 0.63, 0.05 frequencies for calpastatin gene. The results obtained for the callipyge gene revealed that only the wild-type allele A was observed, indicating that only genotype AA was present in the population under consideration.
39
11286
Egg Yolk Peptide Stimulated Osteogenic Gene Expression
Abstract:
Postmenopausal osteoporosis is characterized by low bone density which leads to increased bone fragility and greater susceptibility to fracture. Current treatments for osteoporosis are dominated by drugs that inhibit bone resorption although they also suppress bone formation that may contribute to pathogenesis of osteonecrosis. To restore the extensive bone loss, there is a great need for anabolic treatments that induce osteoblasts to build new bone. Pre-osteoblastic cells produce proteins of the extra-cellular matrix, including type I collagen at first, and then to successively produce alkaline phosphatase (ALP) and osteocalcin during differentiation to osteoblasts. Finally, osteoblasts deposit calcium. Present study investigated the effects of egg yolk peptide (EYP) on osteogenic activities and bone matrix gene expressions in human osteoblastic MG-63 cells. The effects of EYP on cell proliferation, alkaline phosphatase (ALP) activity, collagen synthesis, and mineralization were measured. The expression of osteogenic genes including COL1A1 (collagen, type I, alpha 1), ALP, BGLAP (osteocalcin), and SPP1 (secreted phosphoprotein 1, osteopontin) were measured by quantitative realtime PCR. EYP dose-dependently increased MG-63 cell proliferation, ALP activity, collagen synthesis, and calcium deposition. Furthermore, COL1A1, ALP, and SPP1 gene expressions were increased by EYP treatment. Present study suggested that EYP treatment enhanced osteogenic activities and increased bone matrix osteogenicgenes. These results could provide a mechanistic explanation for the bone-strengthening effects of EYP.
38
93300
Plant Mediated RNAi Approach to Knock Down Ecdysone Receptor Gene of Colorado Potato Beetle
Abstract:
RNA interference (RNAi) has proved its usefulness in functional genomic research on insects recently and is considered potential strategy in crop improvement for the control of insect pests. The different insect pests incur significant losses to potato yield worldwide, Colorado Potato Beetle (CPB) being most notorious one. The present study focuses to knock down highly specific 20-hydroxyecdysone hormone-receptor complex interaction by using RNAi approach to silence Ecdysone receptor (EcR) gene of CPB in transgenic potato plants expressing dsRNA of EcR gene. The partial cDNA of Ecdysone receptor gene of CPB was amplified using specific primers in sense and anti-sense orientation and cloned in pRNAi-GG vector flanked by an intronic sequence (pdk). Leaf and internodal explants of Lady Olympia, Agria and Granola cultivars of potato were infected with Agrobacterium strain LBA4404 harboring plasmid pRNAi-CPB, pRNAi-GFP (used as control). Neomycin phosphotransferase (nptII) gene was used as a plant selectable marker at a concentration of 100 mg L⁻¹. The primary transformants obtained have shown proper integration of T-DNA in plant genome by standard molecular analysis like polymerase chain reaction (PCR), real-time PCR, Sothern blot. The transgenic plants developed out of these cultivars are being evaluated for their efficacy against larvae as well adults of CPB. The transgenic lines are expected to inhibit expression of EcR protein gene, hindering their molting process, hence leading to increased potato yield.
37
9122
Investigating the Successes of in vitro Embryogenesis
Abstract:
The in vitro isolated microspore culture is the most powerful androgenic pathway to produce doubled haploid plants in the short time. To deviate a microspore toward embryogenesis, a number of factors, different for each species, must concur at the same time and place. Once induced, the microspore undergoes numerous changes at different levels, from overall morphology to gene expression. Induction of microspore embryogenesis not only implies the expression of an embryogenic program, but also a stress-related cellular response and a repression of the gametophytic program to revert the microspore to a totipotent status. As haploid single cells, microspore became a strategy to achieve various objectives particularly in genetic engineering. In this communication we would show the most recent advances in the producing haploid embryos via in vitro isolated microspore culture.
36
30949
The Construction of a Probiotic Lactic Acid Bacterium Expressing Acid-Resistant Phytase Enzyme
Abstract:
The use of probiotics engineered to express specific enzymes has been the subject of considerable attention in poultry industry because of increased nutrient availability and reduced cost of enzyme supplementation. Phytase enzyme is commonly added to poultry feed to improve digestibility and availability of phosphorus from plant sources. To construct a probiotic with potential of phytate degradation, phytase gene (appA) from E. coli was cloned and transformed into two probiotic bacteria Lactobacillus salivarius and Lactococcus lactis. L. salivarous showed plasmid instability, unable to express the gene. The expression of appA gene in L. lactis was analyzed by detecting specific RNA and zymography assay. Phytase enzyme was isolated from cellular extracts of recombinant L. lactis, showing a 46 kDa band upon the SDS-PAGE analysis. Zymogram also confirmed the phytase activity of the 46 kDa band corresponding to the enzyme. An enzyme activity of 4.9U/ml was obtained in cell extracts of L. lactis. The growth of native and recombinant L. lactis was similar in the presence of two concentrations of ox bile.
35
39325
Freedom of Expression and Its Restriction in Audiovisual Media
Authors:
Abstract:
Audio visual communication is a type of collective expression. Collective expression activity informs the masses, gives direction to opinions and establishes public opinion. Due to these characteristics, audio visual communication must be subjected to special restrictions. This has been stipulated in both the Constitution and the European Human Rights Agreement. This paper aims to review freedom of expression and its restriction in audio visual media. For this purpose, the authorisation of the Radio and Television Supreme Council to impose sanctions as an independent administrative authority empowered to regulate the field of audio visual communication has been reviewed with regard to freedom of expression and its limits.
34
30063
Expression of ACSS2 Genes in Peripheral Blood Mononuclear Cells of Patients with Alzheimer’s Disease
Abstract:
The impairment of lipid metabolism in the central nervous system has been suggested as a critical factor of Alzheimer’s disease (AD) pathogenesis. Homo sapiens acyl-coenyme A synthetase short-chain family member 2 (ACSS2) gene encodes the enzyme acetyl-Coenzyme A synthetase (AMP forming; AceCS) providing acetyl-coenzyme A (Ac-CoA) for various physiological processes, such as cholesterol and fatty acid synthesis, as well as the citric acid cycle. We investigated ACSS2, transcript variant 1 (ACSS2*1), mRNA levels in the peripheral blood mononuclear cells (PBMC) of patients with AD and compared them with the controls. The study group comprised 50 patients with the diagnosis of AD who have applied to Gaziantep University Faculty of Medicine, and Department of Neurology. 49 healthy individuals without any neurodegenerative disease are included as controls. ACSS2 mRNA expression in PBMC of AD/control patients was 0.495 (95% confidence interval: 0.410-0.598), p= .000000001902). Further studies are needed to better clarify this association.
33
36190
The Importance of including All Data in a Linear Model for the Analysis of RNAseq Data
Abstract:
Studies looking at the changes in gene expression from RNAseq data often make use of linear models. It is also common practice to focus on a subset of data for a comparison of interest, leaving aside the samples not involved in this particular comparison. This work shows the importance of including all observations in the modeling process to better estimate variance parameters, even when the samples included are not directly used in the comparison under test. The human endometrium is a dynamic tissue, which undergoes cycles of growth and regression with each menstrual cycle. The mesenchymal stem cells (MSCs) present in the endometrium are likely responsible for this remarkable regenerative capacity. However recent studies suggest that MSCs also plays a role in the pathogenesis of endometriosis, one of the most common medical conditions affecting the lower abdomen in women in which the endometrial tissue grows outside the womb. In this study we compared gene expression profiles between MSCs and non-stem cell counterparts (‘non-MSC’) obtained from women with (‘E’) or without (‘noE’) endometriosis from RNAseq. Raw read counts were used for differential expression analysis using a linear model with the limma-voom R package, including either all samples in the study or only the samples belonging to the subset of interest (e.g. for the comparison ‘E vs noE in MSC cells’, including only MSC samples from E and noE patients but not the non-MSC ones). Using the full dataset we identified about 100 differentially expressed (DE) genes between E and noE samples in MSC samples (adj.p-val < 0.05 and |logFC|>1) while only 9 DE genes were identified when using only the subset of data (MSC samples only). Important genes known to be involved in endometriosis such as KLF9 and RND3 were missed in the latter case. When looking at the MSC vs non-MSC cells comparison, the linear model including all samples identified 260 genes for noE samples (including the stem cell marker SUSD2) while the subset analysis did not identify any DE genes. When looking at E samples, 12 genes were identified with the first approach and only 1 with the subset approach. Although the stem cell marker RGS5 was found in both cases, the subset test missed important genes involved in stem cell differentiation such as NOTCH3 and other potentially related genes to be used for further investigation and pathway analysis.
32
84694
Molecular Characterisation and Expression of Glutathione S-Transferase of Fasciola Gigantica
Abstract:
Fasciolosis is a widespread economically important parasitic infection throughout the world caused by Fasciola hepatica and F. gigantica. In order to identify novel immunogen conferring significant protection against fasciolosis, currently, research has been focused on the defined antigens viz. glutathione S-transferase, fatty acid binding protein, cathepsin-L, fluke hemoglobin, paramyosin, myosin and F. hepatica- Kunitz Type Molecule. Among various antigens, GST which plays a crucial role in detoxification processes, i.e. phase II defense mechanism of this parasite, has a unique position as a novel vaccine candidate and a drug target in the control of this disease. For producing the antigens in large quantities and their purification to complete homogeneity, the recombinant DNA technology has become an important tool to achieve this milestone. RT- PCR was carried out using F. gigantica total RNA as template, and an amplicon of 657 bp GST gene was obtained. TA cloning vector was used for cloning of this gene, and the presence of insert was confirmed by blue-white selection for recombinant colonies. Sequence analysis of the present isolate showed 99.1% sequence homology with the published sequence of the F. gigantica GST gene of cattle origin (accession no. AF112657), with six nucleotide changes at 72, 74, 423, 513, 549 and 627th bp found in the present isolate, causing an overall change of 4 amino acids. The 657 bp GST gene was cloned at BamH1 and HindIII restriction sites of the prokaryotic expression vector pPROEXHTb in frame with six histidine residues and expressed in E. coli DH5α. Recombinant protein was purified from the bacterial lysate under non-denaturing conditions by the process of sonication after lysozyme treatment and subjecting the soluble fraction of the bacterial lysate to Ni-NTA affinity chromatography. Western blotting with rabbit hyper-immune serum showed immuno-reactivity with 25 kDa recombinant GST. Recombinant protein detected F. gigantica experimental as well as field infection in buffaloes by dot-ELISA. However, cross-reactivity studies on Fasciola gigantica GST antigen are needed to evaluate the utility of this protein in the serodiagnosis of fasciolosis.
31
110019
Human Papillomavirus Type 16 E4 Gene Variation as Risk Factor for Cervical Cancer
Abstract:
HPV16 E4 gene plays an important role in viral genome amplification and release. Therefore, a variation of the E4 gene nucleic acid sequence may affect the carcinogenicity of HPV16. In order to understand the relationship between the variation of HPV16 E4 gene and cervical cancer, this study was to amplify and sequence the DNA sequences of E4 genes in 118 HPV16-positive cervical cancer patients and 151 HPV16-positive asymptomatic individuals. After obtaining E4 gene sequences, the phylogenetic trees were constructed by the Neighbor-joining method for gene variation analysis. The results showed that: 1) The distribution of HPV16 variants between the case group and the control group differed greatly (P = 0.015),and the Asian-American(AA)variant was likely to relate to the occurrence of cervical cancer. 2) DNA sequence analysis showed that there were significant differences in the distribution of 8 variants between the case group and the control group (P < 0.05). And 3) In European (EUR) variant, two variations, C3384T (L18L) and A3449G (P39P), were associated with the initiation and development of cervical cancer. The results suggested that the variation of HPV16 E4 gene may be a contributor affecting the occurrence as well as the development of cervical cancer, and different HPV16 variants may have different carcinogenic capability.
30
79418
Bcl-2: A Molecule to Detect Oral Cancer and Precancer
Abstract:
Introduction: Oral squamous cell carcinoma is the most common malignant tumor of the oral cavity. Normally the death of cell and the growth are active processes and depend not only on external factors but also on the expression of genes like Bcl-2, which activate and inhibit apoptosis. The term Bcl-2 is an acronym for B-cell lymphoma/ leukemia -2 genes. Objectives: An attempt was made to evaluate Bcl-2 oncoprotein expression in patients with oral precancer and cancer and to assess possible correlation between Bcl-2 oncoprotein expression and clinicopathological features of oral precancer and cancer. Material and Methods: This is a selective prospective clinical and immunohistochemical study. Clinicopathological examination is correlated with immunohistochemical findings. The immunolocalization of Bcl-2 protein is performed using the labeled streptavidin biotin (LSAB) method. To visualize the reaction, 3, 3-diaminobenzidine (DAB) is used. Results: Bcl-2 expression was positive in 11 [36.66 %, low Bcl-2 expression 3 (10.00 %), moderate Bcl-2 expression 7 (23.33 %), and high Bcl-2 expression 1 (3.33 %)] oral cancer cases and in 14 [87.50 %, low expression 8 (50 %), moderate expression 6 (37.50 %)] precancer cases. Conclusion: On the basis of the results of our study we conclude that positive Bcl-2 expression may be an indicator of poor prognosis in oral cancer and precancer. Relevance: It has been reported that there is deregulation of Bcl-2 expression during progression from oral epithelial dysplasia to squamous cell carcinoma. It can be used for revealing progression of epithelial dysplasia to malignancy and as a prognostic marker in oral precancer and cancer.
29
40644
YHV-Responsive Gene Expression under the Influence of PmRelish Regulation
Abstract:
In animals, infection by Gram-negative bacteria and certain viruses activates the Imd signaling pathway wherein the a NF-κB transcription factor, Relish, is a key regulatory protein for the synthesis of antimicrobial proteins. Infection by yellow head virus (YHV) activates the Imd pathway. To investigate the expression of genes involved in YHV infection and under the influence of PmRelish regulation, RNA interference and suppression subtractive hybridization (SSH) are employed. The genes in forward library expressed in shrimp after YHV infection and under the activity of PmRelish were obtained by subtracting the cDNAs from YHV-infected and PmRelish-knockdown shrimp with cDNAs from YHV-infected shrimp. Opposite subtraction gave a reverse library whereby an alternative set of genes under YHV infection and no PmRelish expression was obtained. Sequencing of 252 and 99 cDNA clones from the respective forward and reverse libraries were done and annotated through blast search against the GenBank sequences. Genes involved in defense and homeostasis were abundant in both libraries, 31% and 23% in the forward and reverse libraries, respectively. They were predominantly antimicrobial proteins, proteinases and proteinase inhibitors. The expression of antimicrobial protein genes, ALFPm3, crustinPm1, penaeidin3 and penaeidin5 were tested under PmRelish silencing and Gram-negative bacterium V. harveyi infection. Together with the results previously reported, the expression of penaeidin5 and also penaeidin3 but not ALFPm3 and crustinPm1 were under the regulation of PmRelish in the Imd pathway.
28
84908
Optimising Light Conditions for Recombinant Protein Production in the Microalgal Chlamydomonas reinhardtii Chloroplast
Abstract:
The green alga C. reinhardtii provides a platform for the cheap, scalable, and safe production of complex proteins. Despite gene expression in photosynthetic organisms being tightly regulated by light, most expression studies have analysed chloroplast recombinant protein production under constant light. Here the influence of illumination time and intensity on GFP and a GFP-PlyGBS (bacterial-lysin) fusion protein expression was investigated. The expression of both proteins was strongly influenced by the light regime (6-24 hr illumination per day), the light intensity (0-450 E m⁻²s⁻¹) and growth condition (photoautotrophic, mixotrophic and heterotrophic). Heterotrophic conditions resulted in relatively low recombinant protein yields per unit volume, despite high protein yields per cell, due to low growth rates. Mixotrophic conditions exhibited the highest yields at 6 hrs illumination at 200µE m⁻²s⁻¹ and under continuous low light illumination (13-16 mg L⁻¹ GFP and 1.2-1.6 mg L⁻¹ GFP-PlyGBS), as these conditions supported good cell growth and cellular protein yields. A ~23-fold increase in protein accumulation per cell and ~9-fold increase L⁻¹ culture was observed compared to standard constant 24 hr illumination for GFP-PlyGBS. The highest yields under photoautotrophic conditions were obtained under 9 hrs illumination (6 mg L⁻¹ GFP and 2.1 mg L⁻¹ GFP-PlyGBS). This represents a ~4-fold increase in cellular protein accumulation for GFP-PlyGBS. On a volumetric basis the highest yield was at 15 hrs illumination (~2-fold increase L⁻¹ over the constant light for GFP-PlyGBS). Optimising illumination conditions to balance growth and protein expression can thus significantly enhance overall recombinant protein production in C. reinhardtii cultures.
27
100726
Alternating Expectation-Maximization Algorithm for a Bilinear Model in Isoform Quantification from RNA-Seq Data
Abstract:
Estimation of isoform-level gene expression from RNA-seq data depends on simplifying assumptions, such as uniform reads distribution, that are easily violated in real data. Such violations typically lead to biased estimates. Most existing methods provide a bias correction step(s), which is based on biological considerations, such as GC content–and applied in single samples separately. The main problem is that not all biases are known. For example, new technologies such as single-cell RNA-seq (scRNA-seq) may introduce new sources of bias not seen in bulk-cell data. This study introduces a method called XAEM based on a more flexible and robust statistical model. Existing methods are essentially based on a linear model Xβ, where the design matrix X is known and derived based on the simplifying assumptions. In contrast, XAEM considers Xβ as a bilinear model with both X and β unknown. Joint estimation of X and β is made possible by simultaneous analysis of multi-sample RNA-seq data. Compared to existing methods, XAEM automatically performs empirical correction of potentially unknown biases. XAEM implements an alternating expectation-maximization (AEM) algorithm, alternating between estimation of X and β. For speed XAEM utilizes quasi-mapping for read alignment, thus leading to a fast algorithm. Overall XAEM performs favorably compared to other recent advanced methods. For simulated datasets, XAEM obtains higher accuracy for multiple-isoform genes, particularly for paralogs. In a differential-expression analysis of a real scRNA-seq dataset, XAEM achieves substantially greater rediscovery rates in an independent validation set.
26
59256
Expression of Fused Plasmodium falciparum Orotate Phosphoribosyltransferase and Orotidine 5'-Monophosphate Decarboxylase in Escherichia coli
Abstract:
Fusion of the last two enzymes in the pyrimidine biosynthetic pathway in the inversed order by having COOH-terminal orotate phosphoribosyltransferase (OPRT) and NH2-terminal orotidine 5'-monophosphate decarboxylase (OMPDC), as OMPDC-OPRT, are described in many organisms. In this study, we constructed gene fusions of Plasmodium falciparum OMPDC-OPRT (1,836 bp) in pTrcHisA vector and expressed as an 6xHis-tag bifunctional protein in three Escherichia coli strains (BL21, Rosetta, TOP10) at 18 °C, 25 °C and 37 °C. The recombinant bifunctional protein was partially purified by Ni-Nitrilotriacetic acid-affinity chromatography. Specific activities of OPRT and OMPDC domains in the bifunctional enzyme expressed in E. coli TOP10 cells were approximately 3-4-fold higher than those in BL21 cells. There were no enzymatic activities when the construct vector expressed in Rosetta cells. Maximal expression of the fused gene was observed at 18 °C and the bifunctional enzyme had specific activities of OPRT and OMPDC domains in a ratio of 1:2. These results provide greater yields and better catalytic activities of the bifunctional OMPDC-OPRT enzyme for further purification and kinetic study.
25
17385
Expression of Interferon-Lambda Receptor-(IFN-λRα) in Mononuclear Phagocyte Cells (MPCs) Is Influenced by the Levels of Newly Discovered Type III IFN-λ4 in Vitro
Abstract:
IFNλR1 and IL10R2 collectively construct a heterodimer, which is an acknowledged functional receptor for all type III interferons (IFNs). Expression of IFNλR1 is highly tissue specific, which can help in making type III IFNs a drug of choice as comparable to its analogue, type I IFNs, for treating hepatitis C in the near future. Although, expression of IFNλR1 also varies with the concentration of type I IFNs, but in this study it was shown that the expression of IFNλR1 varies with the protein titers of IFN-α, IFN-λ3 and the newly discovered IFN-λ4. High dosage of IFN-α reduces the expression of IFNλR1 in HepG2 cells, which can affect the antiviral activity of type III IFNs in vivo. We premeditated an experimental strategy to differentiate monocytes into dendritic cells (DCs), type I and type II macrophages in vitro and quantified the expression of the IFNλR1 by qPCR. The exposure of newly discovered IFN-λ4 to macrophages and DCs also raised the expression of its own receptor, which shows that expression of IFN-λ4 protein in hepatitis C patient may augment type I treatment and help ease off viral titers. The results of this study may contribute in some understanding towards the mechanisms involved in the selective expression of IFNLR1 and exceptionalities associated with the receptor.
24
117435
The Transcriptional Regulation of Human LRWD1 through DNA Methylation
Abstract:
Leucine-rich repeats and WD repeat domain containing 1 (LRWD1) is highly expressed in the testes of healthy males. On the other hand, LRWD1 is significantly down-regulated in the testicular tissues of patients with severe spermatogenic defects. In our study, the downregulation of LRWD1 expression by shRNA caused a significant reduction of cell growth and mitosis and a noteworthy increase in the cell microtubule atrophy rate. Here, we used EMBOSS CpG plot analysis to explore the promoter region of LRWD1 gene. We found that CpG islands are located between positions -253 to +5 nucleotides upstream from the LRWD1 transcription start site. Luciferase reporter assay revealed that the hypermethylation of the LRWD1 promoter reduced the transcription activity in cells. In addition, quantitative methylation-specific PCR and immunostaining showed that the methylation inhibitor, 5-Aza-2'-deoxycytidine, increased LRWD1 promoter activity, LRWD1 mRNA, protein expression and cell viability. Whereas, the methylation activator, S-adenosylmethionine, caused opposite effects. The overexpression of p53 and Nrf2 in NT2/D1 cells increased LRWD1 promoter activity while 5-fluorodeoxyuridine decreased it. In conclusion, this study highlights evidence that the methylation status of LRWD1 promoter is associated with LRWD1 expression. Since the expression level of LRWD1 plays an important role in spermatogenesis, the methylation status of LRWD1 may serve as a novel molecular diagnostic or therapeutic approach in male's infertility.
23
75721
MicroRNA 200c-3p Regulates Autophagy Mediated Upregulation of Endoplasmic Reticulum Stress in PC-3 Cells
Abstract:
Autophagy is a cellular response to stress or environment on cell survival. Here, we investigated the role of ectopic expression of miR 200c-3p in autophagy. Ectopic expression of miR 200c-3p increased the expression of IRE1alpha, ATF6 and CHOP by western blot and RT-qPCR. Furthermore, the level of microRNA 200c-3p was enhanced by treatment of TG or overexpression of GRP 78. Also, ectopic expression of miR200c-3p increased the LC3 II expression by western blot and RT-qPCR. Also, we found that western blot assay showed that miR200c-3p inhibitor was blocked the starvation–induced LC3II levels. Furthermore, starvation stress increased the level of miR200c-3p in different kinetics. Ectopic expression of miR200c-3p attenuated LC3II expression in IRE1 siRNA transfected PC3 cells. Here, we first demonstrate that miR200c-3p regulates autophagy via ER stress pathway.
22
32160
Managing of Cobalt and Chromium Ions by Patients with Metal-on-Metal Hip Prosthesis
Abstract:
Recently the European Community, in line with the international scientific community such as with the Consensus Statement, has determined to stop the use of metal-on-metal big head stemmed hip prosthesis. Among the factors accounted as responsible for the high failure rates of these hip implants are the release and accumulation of metal ions. Many studies have correlated the presence of these ions, besides other factors, with the induction of oxidative stress response. In our study on 12 subjects, we observed the patient specific capability to eliminate metal ions after revision surgery. While for cobalt all the patients were able to completely excrete cobalt ions within 5-7 months after metal-on-metal bearing removal, for chromium ions it didn’t happen. If on the one hand the toxicokinetic differences between the two types of ions are confirmed by toxicological and occupational studies, on the other hand, this peculiar way of exposition represents a novel and important point of view. Thus, two different approaches were performed to better understand the subject specific capability to transport metal ions (albumin study) and to manage the response to them (heme-oxygenase-1 study): - a mutational screening of ALBUMIN gene was conducted in 30 MoM prosthetic patients resulting in the absence of nucleotidic changes compared with the ALB reference sequence. To this study was also added the analysis of expression of modified albumin protein; - a gene and protein expression study on 44 patients of heme-oxygenase-1, that is one of the most important antioxidant enzyme induced by metallic ions, was performed. This study resulted in no statistically significant differences in the expression of the gene and protein heme-oxygenase-1 between prosthetic and non-prosthetic patients, as well as between patients with high and low ions levels. Our results show that the protein studied (albumin and heme-oxygenase-1) seem to be not involved in determining chromium and cobalt ions level. On the other hand, achromium and cobalt elimination rates are different, but similar in all patients analyzed, suggesting that this process could be not patient-related. We support the importance of researching more about ions transport within the organism once released by hip prosthesis, about the chemical species involved, the districts where they are contained and the mechanisms of elimination, not excluding the existence of a subjective susceptibility to these metals ions.
21
64272
Expression of Selected miRNAs in Placenta of the Intrauterine Restricted Growth Fetuses in Cattle
Abstract:
The placenta is one of the most important organs that plays a crucial role in the fetal growth and development. Placenta dysfunction is one of the primary cause of the intrauterine growth restriction (IUGR). Cattle have the cotyledonary placenta which consists of two anatomical parts: fetal and maternal. In the case of cattle during the first months of pregnancy, it is very easy to separate maternal caruncle from fetal cotyledon tissue, easier in fact than removing an ordinary glove from one's hand. Which in fact make easier to conduct tissue-specific molecular studies. Typically, animal models for the study of IUGR are created using surgical methods and malnutrition of the pregnant mother or in the case of mice by genetic modifications. However, proposed cattle model with MIMT1Del/WT deletion is unique because it was created without any surgical methods what significantly distinguish it from the other animal models. The primary objective of the study was to identify differential expression of selected miRNAs in the placenta from normal and intrauterine growth restricted fetuses. There was examined the expression of miRNA in the fetal and maternal part of the placenta from 24 fetuses (12 samples from the fetal part of the placenta and 12 samples from maternal part of the placenta). In the study, there was done miRNAs sequencing in the placenta of MIMT1Del/WT fetuses and MIMT1WT/WT fetuses. Then, there were selected miRNAs that are involved in fetal growth and development. Analysis of miRNAs expression was conducted on ABI7500 machine. miRNAs expression was analyzed by reverse-transcription polymerase chain reaction (RT-PCR). As the reference gene was used SNORD47. The results were expressed as 2ΔΔCt: ΔΔCt = (Ctij − CtSNORD47j) − (Cti1 − CtSNORD471). Where Ctij and CtSNORD47j are the Ct values for gene i and for SNORD47 in a sample (named j); Cti1 and CtSNORD471 are the Ct values in sample 1. Differences between groups were evaluated with analysis of variance by using One-Way ANOVA. Bonferroni’s tests were used for interpretation of the data. All normalised miRNA expression values are expressed on a value of natural logarithm. The data were expressed as least squares mean with standard errors. Significance was declared when P < 0.05. The study shows that miRNAs expression depends on the part of the placenta where they origin (fetal or maternal) and on the genotype of the animal. miRNAs offer a particularly new approach to study IUGR. Corresponding tissue samples were collected according to the standard veterinary protocols according to the European Union Normative for Care and Use of Experimental Animals. All animal experiments were approved by the Animal Ethics Committee of the State Provincial Office of Southern Finland (ESAVI-2010-08583/YM-23).
20
12859
Analysis of OPG Gene Polymorphism T245G (rs3134069) in Slovak Postmenopausal Women
Abstract:
Osteoporosis is a common multifactorial disease with a strong genetic component characterized by reduced bone mass and increased risk of fractures. Genetic factors play an important role in the pathogenesis of osteoporosis. The aim of our study was to identify the genotype and allele distribution of T245G polymorphism in OPG gene in Slovak postmenopausal women. A total of 200 unrelated Slovak postmenopausal women with diagnosed osteoporosis and 200 normal controls were genotyped for T245G (rs3134069) polymorphism of OPG gene. Genotyping was performed using the Custom Taqman®SNP Genotyping assays. Genotypes and alleles frequencies showed no significant differences (p=0.5551; p=0.6022). The results of the present study confirm the importance of T245G polymorphism in OPG gene in the pathogenesis of osteoporosis.
19
75023
Effects of Valproate on Vascular Endothelial Growth Factor in the Retina Associated with Choroidal Neovascularization
Abstract:
Valproate (VPA) is commonly used in the treatment of bipolar disorder and epilepsy. The mechanism is complicated, including its ability to inhibit histone deacetylases (HDACs). Here, we show that VPA attenuated VEGF gene expression and the morphological changes in choroidal neovascularization (CNV) induced by photocoagulation in retina. C57BL/6 mice were injected subcutaneously at 300mg/kg twice daily with VPA before insult. Vascular endothelial growth factor (VEGF)-A and VEGF-B were examined in the eyes of VPA-treated mice and in human retinal pigment epithelial cell lines (ARPE-19) exposed to VPA. In addition, CNV was induced by photocoagulation in mice injected with VPA, and the volume of CNV was compared by fluorescence-labeled choroidal flat mount. Morphological changes were analyzed on stained histological sections. Western blot analysis was used to determine protein levels of VEGF-A and VEGF-B, and acetylation of histone H3 in each group. VPA injected intraperitoneally attenuated the VEGF-A and VEGF-B expression in the retina, accompanied by the hyperacetylation of retina tissue, indicating that VPA acts directly on retina tissues through acetylation to reduce the expression of VEGF. VPA also attenuated the VEGF-A mRNA expression in the retinal pigment epithelium showed by immunohistochemistry. Moreover, the administration of VPA significantly attenuated photocoagulation-induced CNV in mice. These results demonstrate that VPA attenuated VEGF production in retina associated with choroidal neovascularization possibly via the HDAC inhibition.
18
13162
A Comparative Soft Computing Approach to Supplier Performance Prediction Using GEP and ANN Models: An Automotive Case Study
Abstract:
In multi-echelon supply chain networks, optimal supplier selection significantly depends on the accuracy of suppliers’ performance prediction. Different methods of multi criteria decision making such as ANN, GA, Fuzzy, AHP, etc have been previously used to predict the supplier performance but the “black-box” characteristic of these methods is yet a major concern to be resolved. Therefore, the primary objective in this paper is to implement an artificial intelligence-based gene expression programming (GEP) model to compare the prediction accuracy with that of ANN. A full factorial design with %95 confidence interval is initially applied to determine the appropriate set of criteria for supplier performance evaluation. A test-train approach is then utilized for the ANN and GEP exclusively. The training results are used to find the optimal network architecture and the testing data will determine the prediction accuracy of each method based on measures of root mean square error (RMSE) and correlation coefficient (R2). The results of a case study conducted in Supplying Automotive Parts Co. (SAPCO) with more than 100 local and foreign supply chain members revealed that, in comparison with ANN, gene expression programming has a significant preference in predicting supplier performance by referring to the respective RMSE and R-squared values. Moreover, using GEP, a mathematical function was also derived to solve the issue of ANN black-box structure in modeling the performance prediction.
17
26693
Successes on in vitro Isolated Microspores Embryogenesis
Abstract:
The In Vitro isolated micro spore culture is the most powerful androgenic pathway to produce doubled haploid plants in the short time. To deviate a micro spore toward embryogenesis, a number of factors, different for each species, must concur at the same time and place. Once induced, the micro spore undergoes numerous changes at different levels, from overall morphology to gene expression. Induction of micro spore embryogenesis not only implies the expression of an embryogenic program, but also a stress-related cellular response and a repression of the gametophytic program to revert the microspore to a totipotent status. As haploid single cells, micro spore became a strategy to achieve various objectives particularly in genetic engineering. In this study we would show the most recent advances in the producing haploid embryos via In Vitro isolated micro spore culture.
16
78941
Comparison of Extracellular miRNA from Different Lymphocyte Cell Lines and Isolation Methods
Abstract:
The development of a panel of differential gene expression signatures has been of interest in the field of biomarker discovery for radiation exposure. In the absence of the availability of exposed human subjects, lymphocyte cell lines have often been used as a surrogate to human whole blood, when performing ex vivo irradiation studies. The extent of variation between different lymphocyte cell lines is currently unclear, especially with regard to the expression of extracellular miRNA. This study compares the expression profile of extracellular miRNA isolated from different lymphocyte cell lines. It also compares the profile of miRNA obtained when different exosome isolation kits are used. Lymphocyte cell lines were created using lymphocytes isolated from healthy adult males of similar racial descent (Chinese American and Chinese Singaporean) and immortalised with Epstein-Barr virus. The cell lines were cultured in exosome-free cell culture media for 72h and the cell culture supernatant was removed for exosome isolation. Two exosome isolation kits were used. Total exosome isolation reagent (TEIR, ThermoFisher) is a polyethylene glycol (PEG)-based exosome precipitation kit, while ExoSpin (ES, Cell Guidance Systems) is a PEG-based exosome precipitation kit that includes an additional size exclusion chromatography step. miRNA from the isolated exosomes were isolated using miRNEASY minikit (Qiagen) and analysed using nCounter miRNA assay (Nanostring). Principal component analysis (PCA) results suggested that the overall extracellular miRNA expression profile differed between the lymphocyte cell line originating from the Chinese American donor and the cell line originating from the Chinese Singaporean donor. As the gender, age and racial origins of both donors are similar, this may suggest that there are other genetic or epigenetic differences that account for the variation in extracellular miRNA gene expression in lymphocyte cell lines. However, statistical analysis showed that only 3 miRNA genes had a fold difference > 2 at p < 0.05, suggesting that the differences may not be of that great a significance as to impact overall conclusions drawn from different cell lines. Subsequent analysis using cell lines from other donors will give further insight into the reproducibility of results when difference cell lines are used. PCA results also suggested that the method of exosome isolation impacted the expression profile. 107 miRNA had a fold difference > 2 at p < 0.05. This suggests that the inclusion of an additional size exclusion chromatography step altered the subset of the extracellular vesicles that were isolated. In conclusion, these results suggest that extracellular miRNA can be isolated and analysed from exosomes derived from lymphocyte cell lines. However, care must be taken in the choice of cell line and method of exosome isolation used.
15
10963
RNA Interference Technology as a Veritable Tool for Crop Improvement and Breeding for Biotic Stress Resistance
Authors:
Abstract:
The recent discovery of the phenomenon of RNA interference has led to its application in various aspects of plant improvement. Crops can be modified by engineering novel RNA interference pathways that create small RNA molecules to alter gene expression in crops or plant pests. RNA interference can generate new crop quality traits or provide protection against insects, nematodes and pathogens without introducing new proteins into food and feed products. This is an advantage in contrast with conventional procedures of gene transfer. RNA interference has been used to develop crop varieties resistant to diseases, pathogens and insects. Male sterility has been engineered in plants using RNA interference. Better quality crops have been developed through the application of RNA interference etc. The objective of this paper is to highlight the application of RNA interference in crop improvement and to project its potential future use to solve problems of agricultural production in relation to plant breeding.
14
104514
Freedom with Limitations: The Nature of Free Expression in the European Case-Law
Authors:
Abstract:
In the digital age, the spread of the mobile world and the nature of the cyberspace, offers many new opportunities for the prevalence of the fundamental right to free expression, and therefore, for free speech and freedom of the press; however, these new information communication technologies carry many new challenges. Defamation, censorship, fake news, misleading information, hate speech, breach of copyright etc., are only some of the violations, all of which can be derived from the harmful exercise of freedom of expression, all which become more salient in the internet. Here raises the question: how can we eliminate these problems, and practice our fundamental freedom rightfully? To answer this question, we should understand the elements and the characteristic of the nature of freedom of expression, and the role of the actors whose duties and responsibilities are crucial in the prevalence of this fundamental freedom. To achieve this goal, this paper will explore the European practice to understand instructions found in the case-law of the European Court of Human rights for the rightful exercise of freedom of expression.
13
99911
The Effect of Common Daily Schedule on the Human Circadian Rhythms during the Polar Day on Svalbard: Field Study
Abstract:
Any Arctic visitor has to deal with extreme conditions, including constant light during the summer season or constant darkness during winter time. Light/dark cycle is the most powerful synchronizing signal for biological clock and the absence of daily dark period during the polar day can significantly alter the functional state of the internal clock. However, the inner clock can be synchronized by other zeitgebers such as physical activity, food intake or social interactions. Here, we investigated the effect of polar day on circadian clock of 10 researchers attending the polar base station in the Svalbard region during July. The data obtained on Svalbard were compared with the data obtained before the researchers left for the expedition (in the Czech Republic). To determine the state of circadian clock we used wrist actigraphy followed by sleep diaries, saliva, and buccal mucosa samples, both collected every 4 hours during 24h-interval to detect melatonin by radioimmunoassay and clock gene (PER1, BMAL1, NR1D1, DBP) mRNA levels by RT-qPCR. The clock gene expression was analyzed using cosinor analysis. From our results, it is apparent that the constant sunlight delayed melatonin onset and postponed the physical activity in the same order. Nevertheless, the clock gene expression displayed higher amplitude on Svalbard compared to the amplitude detected in the Czech Republic. These results have suggested that the common daily schedule at the Svalbard expedition can strengthen circadian rhythm in the environment that is lacking light/dark cycle. In conclusion, the constant sunlight delays melatonin onset, but it still maintains its rhythmic secretion. The effect of constant sunlight on circadian clock can be minimalized by common daily scheduled activity.
12
65544
Gene Expression Analysis for Corals / Zooxanthellae under High Seawater Temperature Stress
Abstract:
Clarifying symbiotic relationships is one of the most important theme for understanding the marine eco-system. Coral reef has been regarded as an important environmental resource. Coral holobiont composed by coral, symbiotic microalgae zooxanthellae, and bacteria have complexed relationship. Zooxanthellae mainly supply organic matter to the host corals through their photosynthetic activity. The symbiotic relationship is indispensable for corals but may easily collapses due to the rise of seawater temperature. However, the molecular mechanism how seawater temperature influences their relationships still remain unclear. In this study, the transcriptomic analysis has applied to elucidate the coral-zooxanthellae relationships under high seawater temperature stress. To observe reactions of corals and zooxanthellae against the rise of seawater temperature, meta-gene expression in coral have been analyzed. The branches from six different colonies of a stony coral, Acropora tenuis, were sampled at nine times by 2016 at two locations, Ishikawabaru and South of Sesoko Island, Okinawa, Japan. The mRNAs extracted from the branches including zooxanthellae were sequenced by illumina HiSeq. Gene Set Enrichment Analysis (GSEA) based on hyper geometric distribution was performed. The seawater temperature at 2016 summer was unusually high, which was caused by El Niño event, and the number of zooxanthellae in coral was decreased in August. GSEA derived the several specific genes expressed in A. tenuis under heat stress conditions. The upregulated genes under heat stress highly related with infection immunity. The downregulated genes significantly contained cell cycle related genes. Thu, it is considered that heat stress cause disorder in cell metabolism of A. tenuis, resulting in serious influence to coral holobiont.
11
37333
CCR5 as an Ideal Candidate for Immune Gene Therapy and Modification for the Induced Resistance to HIV-1 Infection
Abstract:
Introduction: Cc-chemokine receptor-5 (CCR5) is known as a main co-receptor in human immunodeficiency virus type-1 (HIV-1) infection. Many studies showed 32bp deletion (Δ32) in CCR5 gene, provide natural resistance to HIV-1 infection in homozygous individuals. Inducing the resistance mechanism by CCR5 in HIV-1 infected patients eliminated many problems of highly-active-anti retroviral therapy (HAART) drugs like as low safety, side-effects and virus rebounding from latent reservoirs. New treatments solved some restrictions that are based on gene modification and cell therapy. Literature review: The stories of the “Berlin and Boston patients” showed autologous hematopoietic stem cells transplantation (HSCT) could provide effective cure of HIV-1 infected patients. Furthermore, gene modification by zinc finger nuclease (ZFN) demonstrated another successful result again. Despite the other studies for gene therapy by ∆32 genotype, there is another mutation -CCR5 ∆32/m303- that provides HIV-1 resistant. It is a heterozygote genotype for ∆32 and T→A point mutation at nucleotide 303. These results approved the key role of CCR5 gene. Conclusion: Recent studies showed immune gene therapy and cell therapy could provide effective cure for refractory disease like as HIV. Eradication of HIV-1 from immune system was not observed by HAART, because of reloading virus genome from latent reservoirs after stopping them. It is showed that CCR5 could induce natural resistant to HIV-1 infection by the new approaches based on stem cell transplantation and gene modifying.
10
86069
Metformin and Its Combination with Sodium Hydrosulfide Influences Plasma Galectin-3 and CSE/H₂S System in Diabetic Rat's Heart
Abstract:
Background and Aims: Galectin-3 is a marker of subclinical cardiac injury and is elevated in individuals with type 2 diabetes mellitus; while hydrogen sulfide (H₂S), metabolite of sulfur-containing amino acids, is considered having antifibrogenic effects. This study was designed to investigate whether metformin and its combination with NaHS can influence plasma galectin-3 and cystathionine-γ-lyase/hydrogen sulfide (CSE/H₂S) system in diabetic rat’s heart. Methods: 32 healthy male rats (180-250 g) were divided into 4 groups. To induct diabetes, rats (group 2-4) were injected with streptozotocin (STZ, 40 mg/kg/i.p., 0.1 M citrate buffer (pH 4.5). Rats from 3d (STZ+Metf) and 4th (STZ+Metf+NaHS) groups were given metformin (500 mg/kg/day) orally, and rats from 4th (STZ+Metf+NaHS) group were injected sodium hydrosulfide (NaHS, 3 mg/kg/i.p.) once per day starting from 3 to 28 day after streptozotocin injection. Rats of first group (control) were administered the equivalent volumes of 0.9% NaCl. Plasma galectin-3 was measured by ELISA. Rats’ hearts were sampled for determination of H2S by reaction with N,N-Dimethyl-p-phenylenediamine. Determination of CSE gene expression was performed in real time using PCR in the presence of SYBR Green I, using DT-Light detecting amplifier ('DNA-technology', Russia). Results: Induction of streptozotocin diabetes (STZ-diabetes, group 2) was followed by low myocardial H2S concentration and CSE expression (by 35%, p < 0.05 and 60.5%, p < 0.001 respectively, than that in controls), while plasma galectin-3 in this group was significantly higher than in controls (by 3.8 times, p < 0.05). Administration of metformin (group 3) resulted in significantly higher H₂S concentration (by 28.5%, p < 0.05), whereas CSE expression was only by 6% more than that in STZ-diabetes, as well as plasma galectin-3 was only by 14.8% lower in comparison with untreated diabetic rats. The inhibition of H₂S generation and CSE activity by diabetes was greatly attenuated in STZ+Metf+NaHS group. The combination of metformin with NaHS significantly stimulated H₂S production (by 48%, p < 0.05 and 15%, p < 0.05 more than STZ-diabetes and STZ+Metf respectively) and CSE gene expression (by 64.8%, p < 0.05 compared to STZ-diabetes and by 55.4%,p < 0.05 compared to STZ+Metf). Besides, plasma galectin-3 in rats receiving metformin and NaHS was significantly lower by 42%, p < 0.05 and 32.5%, p < 0.05 compared to STZ-diabetes and STZ+Metf groups respectively. Conclusions: To summarize, dysfunction of CSE/H2S system and galectin-3 stimulation was found in streptozotocin-induced diabetic rats. Metformin and its combination with exogenous H2S effectively prevented the development of metabolic changes induced by diabetes. These findings suggest that CSE/H₂S system can be integrated into pathogenesis of diabetic complications through modulation of pro-inflammatory and pro-fibrogenic mediator galectin-3.
9
3159
Pattern Of Polymorphism SLC22A1 Gene In Children With Diabetes Mellitus Type 2
Abstract:
Type 2 diabetes mellitus ( T2DM ) is a syndrome characterized by a state of increased blood sugar levels due to chronic disorders of insulin secretion by pancreatic beta cells and insulin action or a combination of both. The organic cation transporter 1, encoded by the SLC22A1 gene, responsible for the uptake of the antihyperglycemic drug, metformin, in the hepatocyte. We assessed whether a genetic variation in the SLC22A1 gene was associated with the glucose - lowering effect of metformin. Method case study research design. Samples are children with type 2 diabetes mellitus who meet the inclusion criteria. The results proportions SLC22A1 gene polymorphisms in children with diabetes mellitus type 2 amounted to 52.04 % at position 400T/C, there is one heterozygous and one at position 595T/C Conclusion The presence of SLC22A1 gene polymorphisms in children with diabetes mellitus type 2.
8
65598
Deciphering Tumor Stroma Interactions in Retinoblastoma
Abstract:
Background: Tumor microenvironment has been implicated in several cancers to regulate cell growth, invasion and metastasis culminating in outcome of therapy. Tumor stroma consists of multiple cell types that are in constant cross-talk with the tumor cells to favour a pro-tumorigenic environment. Not much is known about the existence of tumor microenvironment in the pediatric intraocular malignancy, Retinoblastoma (RB). In the present study, we aim to understand the multiple stromal cellular subtypes and tumor stromal interactions expressed in RB tumors. Materials and Methods: Immunohistochemistry for stromal cell markers CD31, CD68, alpha-smooth muscle (α-SMA), vimentin and glial fibrillary acidic protein (GFAP) was performed on formalin fixed paraffin embedded tissues sections of RB (n=12). The differential expression of stromal target molecules; fibroblast activation protein (FAP), tenascin-C (TNC), osteopontin (SPP1), bone marrow stromal antigen 2 (BST2), stromal derived factor 2 and 4 (SDF2 and SDF4) in primary RB tumors (n=20) and normal retina (n=5) was studied by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and Western blotting. The differential expression was correlated with the histopathological features of RB. The interaction between RB cell lines (Weri-Rb-1, NCC-RbC-51) and Bone marrow stromal cells (BMSC) was also studied using direct co-culture and indirect co-culture methods. The functional effect of the co-culture methods on the RB cells was evaluated by invasion and proliferation assays. Global gene expression was studied by using Affymetrix 3’ IVT microarray. Pathway prediction was performed using KEGG and the key molecules were validated using qRT-PCR. Results: The immunohistochemistry revealed the presence of several stromal cell types such as endothelial cells (CD31+;Vim+/-); macrophages (CD68+;Vim+/-); Fibroblasts (Vim+; CD31-;CD68- );myofibroblasts (α-SMA+/ Vim+) and invading retinal astrocytes/ differentiated retinal glia (GFAP+; Vim+). A characteristic distribution of these stromal cell types was observed in the tumor microenvironment, with endothelial cells predominantly seen in blood vessels and macrophages near actively proliferating tumor or necrotic areas. Retinal astrocytes and glia were predominant near the optic nerve regions in invasive tumors with sparse distribution in tumor foci. Fibroblasts were widely distributed with rare evidence of myofibroblasts in the tumor. Both gene and protein expression revealed statistically significant (P< 0.05) up-regulation of FAP, TNC and BST2 in primary RB tumors compared to the normal retina. Co-culture of BMSC with RB cells promoted invasion and proliferation of RB cells in direct and indirect contact methods respectively. Direct co-culture of RB cell lines with BMSC resulted in gene expression changes in ECM-receptor interaction, focal adhesion, IL-8 and TGF-β signaling pathways associated with cancer. In contrast, various metabolic pathways such a glucose, fructose and amino acid metabolism were significantly altered under the indirect co-culture condition. Conclusion: The study suggests that the close interaction between RB cells and the stroma might be involved in RB tumor invasion and progression which is likely to be mediated by ECM-receptor interactions and secretory factors. Targeting the tumor stroma would be an attractive option for redesigning treatment strategies for RB.
7
13903
Carriage of 675 4G/5G Polymorphism in PAI-1 Gene and Its Association with Early Pregnancy Losses in Patients with Polycystic Ovary Syndrome
Abstract:
Leptin and PAI-1 are important cytokines and may play a role in the regulation of PCOS development. PCOS is frequently associated with obesity, high BMI index and consequently with increased risk of metabolic disorders. The aim of the present study was to evaluate PAI-1 levels, genetic influence of the carriage of 675 4G/5G polymorphism in PAI-1 gene and leptin as a marker of obesity in the development of PCOS. Methods: Genotyping in 84 patients with PCOS and PCO and 100 healthy control subjects to detect single nucleotide deletion 675 G in the promoter of PAI-1 gene. The present study provides evidence that SNP 4G in the PAI-1 gene is associated with early pregnancy losses in patients with polycystosis. Further to this, there is a correlation between leptin levels, PAI-1 levels and BMI in the patients with PCOS, which confirms the role of obesity as a risk factor for PCOS.
6
47847
Role of Tyrosine-Phosphorylated STAT3 in Liver Regeneration: Survival, DNA Synthesis, Inflammatory Reaction and Liver Mass Recovery
Abstract:
In liver regeneration, quiescent hepatocytes need to be primed to fully respond to growth factors such as hepatocyte growth factor. To understand the priming process, it is necessary to analyze patterns of gene expression that occur during liver regeneration after partial hepatectomy (PHx). Recently, tyrosine phosphorylation of signal transducer and activator of transcription 3 (pYSTAT3) has been shown to play an important role in initiating liver regeneration. In order to evaluate the role of pYSTAT3 on liver regeneration after PHx, we used an intrabody which can selectively inhibit pYSTAT3. In our previous studies, an intrabody had been shown that it bound specifically to the pYSTAT3. Adenovirus-mediated expression of the intrabody in HepG2 cells, as well as mouse liver, blocked both accumulation of pYSTAT3 in the nucleus and downstream target of pYSTAT3. In this study, PHx was performed on intrabody-expressing mice and the expression levels of liver regeneration-related genes were analyzed. We also measured liver/body weight ratios and the related cellular signaling pathways were analyzed. Acute phase response genes were reduced in an intrabody-expressing mice during liver regeneration than in control virus-injected mice. However, the time course of liver mass restoration in intrabody-expressing mice was similar to that observed in control virus-injected mice. We also observed that the expression levels of anti-apoptotic genes, such as Bcl2 and Bcl-xL were decreased in intrabody-expressing mice whereas the expression of cell cycle-related genes such as cyclin D1, and c-myc was increased. Liver regeneration after PHx was partially impaired by the selective inhibition of pYSTAT3 with a phosphorylation site-specific intrabody and these results indicated that pYSTAT3 might have limited role in liver mass recovery.
5
69413
Effect of Zinc Nanoparticles on Oxidative Stress-Related Genes and Antioxidant Enzymes Activity in the Brain of Oreochromis Niloticus and Tilapia Zillii
Abstract:
This study was carried out to determine the median lethal concentrations (LC50) of Zinc nanoparticles (ZnNPs) on Oreochromis niloticus and Tilapia zillii. The biochemical and molecular potential effects of ZnNPs (500 and 2000 μg L−1) on the antioxidant system in the brain tissue of O. niloticus and T. zillii were investigated. Four hundred fish were used for acute and sub-acute studies. ZnNP LC50 concentrations were investigated in O. niloticus and T. zillii. The effect of 500 and 2000 μg L−1 ZnNPs on brain antioxidants of O. niloticus and T. zillii was investigated. The result indicated that 69 h LC50 was 5.5 ± 0.6 and 5.6 ± 0.4 for O. nilotica and T. zillii, respectively. Fish exposed to 500 μg L−1 ZnNPs showed a significant increase in reduced glutathione (GSH), total glutathione (tGSH) levels, superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx) and glutathione-S-transferase (GST) activity and gene expression. On the contrary, malondialdehyde (MDA) levels significantly decreased. Meanwhile, fish exposed to 2000 μg L−1 ZnNPs showed a significant decrease of GSH, tGSH levels, SOD, CAT, GR, GPx and GST activity and gene expression. On the contrary, MDA levels significantly increased. It was concluded that, the 96 h LC50 of ZnNPs was 5.5 ± 0.6 and 5.6 ± 0.4 for O. nilotica and T. zillii, respectively. ZnNPs in exposure concentrations of 2000 μg/L induced a deleterious effect on the brain antioxidant system of O. nilotica and T. zillii. In contrast, ZnNPs in exposure concentrations of 500 μg L−1 produced an inductive effect on the brain antioxidant system of O. nilotica and T. zillii.
4
114439
Real Time PCR Analysis of microRNA Expression in Oral Cancer
Authors:
Abstract:
Many mechanisms are involved in the control of cellular differentiation and growth, which are often dysregulated in many cancers. Many distinct pathways are involved in these mechanisms of control, including deoxyribonuclease (DNA) methyltransferase and histone deacetylase (HDAC) activation that controls both genetic and epigenetic modifications and micro ribonucleic acid (RNA) expression. Less is known about the expression of DNA methyltransferase (DNMT) and HDAC in oral cancers and the effect on microRNA expression. The primary objective of this study was to evaluate the expression of DNMT and HDAC family members in oral cancer and the concomitant expression of cancer-associated microRNAs. Using commercially available oral cancers, including squamous cell carcinoma (SCC)-4, SCC-9, SCC-15, and SCC-25, RNA was extracted and screened for DNMT, HDAC, and microRNA expression using highly-specific primers and quantitative polymerase chain reaction (qPCR). These data revealed low or absent expression of DNMT-1, which is associated with cellular differentiation but increased expression of DNMT-3a and DNMT-3b in all SCC cell lines compared with normal non-cancerous cell controls. In addition, no expression of HDAC1 and HDAC2 expression was found among the normal, non-cancerous cells but was highly expressed in each of the SCC cell lines examined. Differential expression of oncogenic and cancer-associated microRNAs was also observed among the SCC cell lines, including miR-21, miR-133, miR-149, miR-155, miR-365, and miR-720. These findings also appeared to vary according to observed growth rates among these cells. These data may be the first to demonstrate the expression and association between HDAC and DNMT3 family members among oral cancers. In addition, the differential expression of these epigenetic modifiers may be associated with the expression of specific microRNAs in these cancers, which have not previously been observed to the best of the author's knowledge. In addition, some associations and relationships may exist between the expression of these biomarkers and the rates of growth and proliferation, which may suggest that these expression patterns might represent potentially useful biomarkers to determine tumor aggressiveness and other phenotypic behaviors among oral cancers.
3
18384
Toxicological Validation during the Development of New Catalytic Systems Using Air/Liquid Interface Cell Exposure
Abstract:
Toluene is one of the most used Volatile Organic Compounds (VOCs) in the industry. Amongst VOCs, Benzene, Toluene, Ethylbenzene and Xylenes (BTEX) emitted into the atmosphere have a major and direct impact on human health. It is, therefore, necessary to minimize emissions directly at source. Catalytic oxidation is an industrial technique which provides remediation efficiency in the treatment of these organic compounds. However, during operation, the catalysts can release some compounds, called byproducts, more toxic than the original VOCs. The catalytic oxidation of a gas stream containing 1000ppm of toluene on Pd/α-Al2O3 can release a few ppm of benzene, according to the operating temperature of the catalyst. The development of new catalysts must, therefore, include chemical and toxicological validation phases. In this project, A549 human lung cells were exposed in air/liquid interface (Vitrocell®) to gas mixtures derived from the oxidation of toluene with a catalyst of Pd/α-Al2O3. Both exposure concentrations (i.e. 10 and 100% of catalytic emission) resulted in increased gene expression of Xenobiotics Metabolising Enzymes (XME) (CYP2E1 CYP2S1, CYP1A1, CYP1B1, EPHX1, and NQO1). Some of these XMEs are known to be induced by polycyclic organic compounds conventionally not searched during the development of catalysts for VOCs degradation. The increase in gene expression suggests the presence of undetected compounds whose toxicity must be assessed before the adoption of new catalyst. This enhances the relevance of toxicological validation of such systems before scaling-up and marketing.
2
88664
Cotton Fiber Quality Improvement by Introducing Sucrose Synthase (SuS) Gene into Gossypium hirsutum L.
Abstract:
The demand for long staple fiber having better strength and length is increasing with the introduction of modern spinning and weaving industry in Pakistan. Work on gene discovery from developing cotton fibers has helped to identify dozens of genes that take part in cotton fiber development and several genes have been characterized for their role in fiber development. Sucrose synthase (SuS) is a key enzyme in the metabolism of sucrose in a plant cell, in cotton fiber it catalyzes a reversible reaction, but preferentially converts sucrose and UDP into fructose and UDP-glucose. UDP-glucose (UDPG) is a nucleotide sugar act as a donor for glucose residue in many glycosylation reactions and is essential for the cytosolic formation of sucrose and involved in the synthesis of cell wall cellulose. The study was focused on successful Agrobacterium-mediated stable transformation of SuS gene in pCAMBIA 1301 into cotton under a CaMV35S promoter. Integration and expression of the gene were confirmed by PCR, GUS assay, and real-time PCR. Young leaves of SuS overexpressing lines showed increased total soluble sugars and plant biomass as compared to non-transgenic control plants. Cellulose contents from fiber were significantly increased. SEM analysis revealed that fibers from transgenic cotton were highly spiral and fiber twist number increased per unit length when compared with control. Morphological data from field plants showed that transgenic plants performed better in field conditions. Incorporation of genes related to cotton fiber length and quality can provide new avenues for fiber improvement. The utilization of this technology would provide an efficient import substitution and sustained production of long-staple fiber in Pakistan to fulfill the industrial requirements.
1
14690
Association of MMP-2,-9 Overexpression and Imbalance PGR-A/PGR-B Ratio in Endometriosis
Abstract:
Introduction: Matrix MetalloProteinases (MMPs) degrade extracellular matrix components to provide normal remodeling and contribute to pathological tissue destruction and cell migration in endometriosis. It is accepted that MMPs are resistant to suppression by progesterone in endometriotic tissues. The physiological effects of progesterone are mediated by its two progesterone receptor (PGR) isoforms, namely PGR-A and PGR-B. The capacity of progesterone affect to gene expression is dependent on the PGR-A/PGR-B ratio. The imbalance ratio in endometriotic tissue may be an important mechanism to be resulted in Progesterone resistance and modify progesterone action via differential regulation of specific progesterone response genes and improve endometriosis disease. Material and methods: RNA was extracted from twenty ectopic (endometriotic) and eutopic (endometrial) tissue samples of women undergoing laparoscopy for endometriosis and 20 healthy fertile women at Royan Institute, Tehran, Iran. Analysis of PGR-A, PGR-B, MMP-2 and MMP-9 mRNA expression was performed using Real-time PCR in ectopic and eutopic tissues. Then, Statistical analysis was calculated according to the 2-ΔΔCT equation for all samples. Results: Quantitative RT–PCR analyses of PGR-A and PGR-B mRNA revealed that there were differences in both isoformes of PGRs mRNA expressions between ectopic and control eutopic tissues. We were able to demonstrate low expression levels of PGR-B isoforms in ectopic tissues. Although, PGR-A expression was significantly higher in the same ectopic samples compare to controls.This method permitted us to demonstrate significant overexpression of MMP-2 and MMP-9 in ectopic samples compared to control endometrial tissues, as well. Conclusions: Our data suggest that low expression levels of PGR-B and overexpression of PGR-A can alter PGR-A/PGR-B ratio in endometriotic ectopic tissues. Imbalance ratio of PGRs in endometriotic tissue may be able to consequence MMP-2 and MMP-9 overexpression which can be important in pathogenesis and treatment of disease.